... a mouse-adapted variant of Ebola Zaire virus J Comp Pathol 2001, 125(4): Volchkov VE, Chepurnov AA, Volchkova VA, Ternovoj VA, Klenk HD: Molecular characterization of guinea pig-adapted variants ... time after infection of the scid mice (Figure 2C–D) As is seen in all other models of filovirus infection, indicators of liver health such as alanine transaminase (ALT) and aspartate transaminase ... To accomplish this goal, we repeatedly passaged the liver homogenates of MARV-infected scid mice and then Mouse adaptation The general approach to adapt MARV to mice was based on virus passage...
Ngày tải lên: 18/06/2014, 18:20
... a mouse-adapted variant of Ebola Zaire virus J Comp Pathol 2001, 125(4): Volchkov VE, Chepurnov AA, Volchkova VA, Ternovoj VA, Klenk HD: Molecular characterization of guinea pig-adapted variants ... time after infection of the scid mice (Figure 2C–D) As is seen in all other models of filovirus infection, indicators of liver health such as alanine transaminase (ALT) and aspartate transaminase ... To accomplish this goal, we repeatedly passaged the liver homogenates of MARV-infected scid mice and then Mouse adaptation The general approach to adapt MARV to mice was based on virus passage...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo y học: "Development of a model of focal pneumococcal pneumonia in young rats" ppsx
... Vaccine and Pediatrics, Pearl River, NY) and David Briles (University of Alabama, Birmingham) and passaged through rats via intraperitoneal challenge as described previously [7] Passaged strains ... Mortality was assessed for days after inoculation Bacteremia was assessed on days and after inoculation The distal dorsal tail vein of each unanesthetized pup was cleansed with 70% alcohol and ... be abrogated by pre-administration of bacterial polysaccharide immune globulin Previously established animal models of pneumococcal invasive disease have several disadvantages The most Page of...
Ngày tải lên: 11/08/2014, 10:23
Development of a model to calculate the economic implications of improving the indoor climate
... graphical model) the variable which affects another variable is called a parent and the variable affected is called a child The child is conditioned by the parent Given A is a parent and B is a ... node (balloon) is a variable with a given number of events also called states, clustered around the variables The states of the variables cause an impact on other variables states visualized ... do, so average assumptions are often applied A probabilistic model may be a more appropriate and an easier implemented approach A probabilistic distribution incorporates the uncertainties of the...
Ngày tải lên: 12/12/2016, 20:32
Báo cáo hóa học: " Development of a mathematical model for predicting electrically elicited quadriceps femoris muscle forces during isovelocity knee joint motion" potx
... a parabolic manner and was modeled as A( θ) = a( 40 - θ)2 + b(40 - θ) + A4 0, (11) where A4 0 is the value of A at 40° of knee flexion, and a and b are constants that need to be identified for each ... FES are probably complex One way to assist the search for the optimal pattern is to use mathematical models that can predict forces accurately to a range of physiological conditions and stimulation ... speed of 200°/s The values of each of the parameters (a, b, A4 0, τ1, τ2, KM, V1, and V2) were then obtained as described above For each of the above relationships we fitted the data with a linear...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Development of a syngeneic mouse model of epithelial ovarian cancer" ppt
... clear cell cancers Progress in ovarian cancer research has been slowed by the lack of suitable animal models that exhibit features of human disease Genetically manipulable mammalian models of ... differentiated carcinomas with few areas of tubular differentiation and occasional papillary structures, e.g., panels c and g All micrographs were taken at the same magnification and the calibration bar ... The availability of an additional syngeneic mouse model of EOC will allow cross-comparison of mouse models and validation of key findings The functional utility of animal models of human cancer...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo y học: " A validity-driven approach to the understanding of the personal and societal burden of low back pain: development of a conceptual and measurement model" doc
... interpretations and applications that are validated To maximize the likelihood of producing valid data in relation to a range of possible interpretations and applications of a tool, there are development ... Education Standards for educational and psychological testing Washington, DC: American Educational Research Association; 1999 30 American Psychological Association., American Educational Research ... interpretation of data at the group level to interpretation at the individual level usually requires additional technical analysis as well as a body of evidence about the meaning and behavior of each scale...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt
... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... that these results are related to the fact that many experts are programme leaders and thus, are more aware of practices that pertain to Leadership Also, experts may have been aware of the fact ... 70 AACVPR: Guidelines for Cardiac Rehabilitation and Secondary Prevention Programs 4th Edition edition American Association of Cardiovascular and Pulmonary Rehabilitation Champaigh, IL.: Human...
Ngày tải lên: 14/08/2014, 08:20
Development of a subcortical emphasized physical human head model for evaluation of deep brain source contribution to scalp EEG
... Investigate the electrical characteristics of the artificial brain, skull and scalp materials (2) Evaluate the reliability of using a human head phantom system for EEG studies (3) Evaluate the capability ... and real-time displayed using asalab™ EEG acquisition software 24 Collected data were off-line examined and processed using asa™ signal analysis software 3.5 Low Resolution Brain Electromagnetic ... sLORETA free academic software would compute the dipole source locations in a brain atlas 25 CHAPTER Electrical Characteristic Study of the Artificial Brain Material Brain occupies most of a human...
Ngày tải lên: 09/09/2015, 10:02
Development of a realistic finite element model of human head and its applications to head injuries
... facial bones and cranial bones as well as intracranial injuries are evaluated based on the tolerance limits of the biomechanical parameters General trend of maximum intracranial biomechanical parameters ... to all of my colleagues and my best friends Arpan Gupta, Guo Shifeng, Zhu Jianhua, Zhuang Han, Liu Yilin, Kyrin Liong, Saeid Arabnejad Khanooki, Shahrokh Sepehri Rahnama, Ahmadali Tahmasebimoradi, ... wave propagation paths in the facial skeleton and the intracranial brain presented to study the association of the traumatic brain injury (TBI) with the facial trauma sequences Fractures of facial...
Ngày tải lên: 10/09/2015, 09:04
Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package
... availability of better CAD tools for the extraction of inductances and capacitances makes the PEEC models attractive PEECs are equivalent to Maxwell’s equations in the limit of an infinite lattice ... APPLICATION OF PEEC MODELING FOR THE DEVELOPMENT OF A NOVEL MULTI-GIGAHERTZ TEST INTERFACE WITH FINE PITCH WAFER LEVEL PACKAGE BY JAYASANKER JAYABALAN M.Sc.(Engg), National University of Singapore ... 2006 J Jayabalan, R Jayaganthan, A. A.O Andrew Tay and B.L Ooi., “Energetics of Copper Nanowires,” International Journal of NanoScience, World Scientific, Singapore, Vol 4, No 4, pp 717-724, Aug 2005...
Ngày tải lên: 11/09/2015, 14:24
Development of a generic three dimensional model for stratified flows
... dredged material usually occur in the dredging of navigation channels and harbors, or in the construction of breakwaters are well as offshore man-made islands Since contaminants are typically bound ... Reynolds Averaged Navier-Stokes Equations The time averaged form of the Navier-Stokes equations are called the Reynolds Averaged 12 Chapter Navier-Stokes (RANS) equations These models calculate a mean, ... large amount of sediments and mud are often disposed of in designated areas of coastal waters As a prerequisite to the environmental impact due to these projects, the dynamics and dispersion of...
Ngày tải lên: 04/10/2015, 15:46
Development of a two dimensional wave model based on the extended boussinesq equations
... momentum balance equations, and phase-averaged models, which are based on a spectral energy balance equation The application of phase-resolving models, which require 10 ~ 100 time steps for each wave ... Freilich and Guza 1984) Although standard Boussinesq models can predict wave transformation in coastal regions with relative accuracy, its range of validity is limited to fairly shallow water (McCowan, ... potential at an arbitrary depth as the dependent variable For regular waves propagating over a slowly varying topography, the governing equations for the velocity potentials of each harmonic are a...
Ngày tải lên: 04/10/2015, 15:52
Development of a new steady state zerodimensional simulation model for woody biomass gasification in a full scale plant
... FLY-ASH 3W-VALVE AIR-FAN AIR-4 AIR-9 F01 VA01 R30-COND AIR-1 AIR-2 AIR-3 E-HEATER Fig Aspen PlusÒ simulation model of the experimental gasification plant Table Ultimate and proximate analyses of chestnut ... relation of Churchill–Bernstein: ae ¼ Rea ¼ qa ua De insulation la A: 10Þ Pra ¼ Cpa la ka A: 11Þ The evaluation of the radiative heat exchange between the cover of the external thermal insulation ... 2014;29:201–15 [5] Ahmad AA, Zawawi NA, Kasim FH, Inayat A Assessing the gasification performance of biomass: a review on biomass gasification process conditions, optimization and economic evaluation Renew...
Ngày tải lên: 01/08/2016, 09:29
Lithium-Ion Battery Systems: A Process Flow And Systems Framework Designed For Use In The Development Of A Lifecycle Energy Model
... milliAmphours/gram; twice that of the LiC6 composition (Gaines and 23 Cuenca, 2000) Additional research and development advancements are being focused in obtaining more capable and stable material (Gaines and ... Thus, research groups are focusing on using silicon as an anode material instead of carbon based graphite Silicon has a high storage capacity of up to ten times that of graphite, but has a shorter ... Gaines and Cuenca (2000) of Argonne National Lab state that, “The different electrode materials have different current-carrying capacities, and this affects the storage capacities of the resultant...
Ngày tải lên: 10/12/2016, 09:56
Development of a method to measure consumer emotions associated with foods
... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate, ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited via internet and/or phone based on ... can get acquainted with the ballot more quickly and shorten the task over each sample evaluation We compared this alphabetized approach with a randomized attribute presentation and found that...
Ngày tải lên: 03/04/2013, 21:07
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the most important vectors International shipping, aquaculture ... Framework - Introd uced Marine Pests Phase – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC Economies Considerations for a Risk Management ... and biodiversity are most threatened values Amount of commercial shipping and number of trading partners affecting pathway strength A limited number of IMP have been identified in APEC Management...
Ngày tải lên: 28/10/2013, 11:15
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from ... cells may cause a dysfunctional cardiac flow and cause the sudden death of the transgenic mice, although it remains to be determined whether T antigen-expressing cardiac valves are functionally affected...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc
... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator The SR830 has a 256 ... He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser excitation Acknowledgements: This work is supported by the Natural ... overlaps Raman spectrum This was proved very clearly in the Raman spectra of the petrol extract sample 5B110 and 5B11 (petrol extracts from Bach Ho, Vietnam) The Raman spectra excited by He-Ne laser...
Ngày tải lên: 05/03/2014, 14:20
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT ... (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new ... CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); for Ga15 (5¢-AT GGCCCGGTCCCTGACTTGG-3¢) and (5¢-TCACAGCA...
Ngày tải lên: 07/03/2014, 16:20