developing a research agenda for the internationalization of fashion retailing

Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers pot

Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers pot

... president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... the United States of America National Academy of Sciences National Academy of Engineering Institute of Medicine National Research Council The National Academy of Sciences is a private, nonprofit, ... from a wide variety of developers and use a variety of hardware and software platforms, some of which may run the latest versions of the software, and others of which may be several generations...

Ngày tải lên: 06/03/2014, 15:20

236 323 1
Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers doc

Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers doc

... of a particular type, or the closest automatic teller machine, or an available parking space The occupants of the car will be able to receive information about the history of the place they are ... from a wide variety of developers and use a variety of hardware and software platforms, some of which may run the latest versions of the software, and others of which may be several generations ... joint graduate programs or joint curriculum endeavors Other Agencies Other agencies such as the Department of Energy (DOE) and the National Aeronautics and Space Administration (NASA) can play an...

Ngày tải lên: 15/03/2014, 15:20

235 259 0
Toward a Research Agenda for the Rochester Shooting Database pptx

Toward a Research Agenda for the Rochester Shooting Database pptx

... in both fatal and nonfatal firearm use can lead toward the fact-based formation of policy and gun regulation Upon gathering this information and analyzing the data, it may be found that different ... focus their attention in order to reduce retaliatory shootings Drug Areas It is axiomatic that the presence of open air drug markets in a particular area elevates levels of crime Research has established ... staging areas where individuals campaign for respect These staging areas often become flashpoints for violence, as individuals use threats or assaults to enhance their street status The important...

Ngày tải lên: 23/03/2014, 12:20

18 326 0
developing a marketing plan for the keywordz service of gapit communication joint-stock company

developing a marketing plan for the keywordz service of gapit communication joint-stock company

... Asistant, product and contract management Methodology Analysis and Generalization : The information in the thesis was analyed and created by a number of documents and records of electronic marketing, ... baseline against which such goals are being set?  What kinds of markets should be targeted and what are the goals for each market segment?  How will the organisation assess the attainment of these ... important information that the customer not want to reveal but they have to inform the company to create the promotion or marketing campaigns for instant total cost for the marketing campain or...

Ngày tải lên: 08/01/2015, 12:41

87 539 0
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the rising prevalence ... national, regional or local level, and to cooperate with similar fora at national level At the same time, the Platform can create input for integrating the responses to the obesity challenge into a...

Ngày tải lên: 14/02/2014, 13:20

22 704 0
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

... present case we can take πB = A , which has the great advantage that the path of ρ does not depend on the paths of the other particles This is the reason why the case DA = DB is special We proved ... constant whose value remains the same throughout this paper (a. s is an abbreviation of almost surely) Acknowledgement The research for this paper was started during a stay by H Kesten at the Mittag-Leffler ... Annals of Mathematics, 167 (2008), 701–766 A shape theorem for the spread of an infection By Harry Kesten and Vladas Sidoravicius Abstract In [KSb] we studied the following model for the...

Ngày tải lên: 16/02/2014, 06:20

67 490 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

... most available in the form of organic compounds, such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria Inasmuch as the bacteria ... from another As far as these characters can be used, they are taken, but in addition, many characteristics of a physiological nature are added The way that the organism grows in different kinds of ... frequently the cans are not cleaned immediately upon arrival at the farm, so that the conditions are favorable for rapid fermentation Many of the taints that bother factories are directly traceable...

Ngày tải lên: 16/02/2014, 22:20

201 541 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

... Influencing the Selection of Education, Marketing, and Law There are many other variables that can influence managers in their selection of education, marketing, and/or law as classes of strategic ... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... their backgrounds and the singular choice of edu cation, marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be...

Ngày tải lên: 18/02/2014, 02:20

14 780 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

... incubated at 37 °C for 20 After centrifugation, the supernatant was used to measure the absorbance at 468 nm The amounts of bilirubin formed in the reaction system were calculated using a value of ... kit (Amersham Biosciences, Piscataway, NJ, USA) Expression of a- tubulin was examined as an internal control using a- tubulin monoclonal antibody (NeoMarkers, Fremont, CA, USA) Assay for HO catalytic ... Functional analysis of cDNAs for two types of human heme oxygenase and evidence for their separate regulation J Biochem (Tokyo) 113, 214–218 Takeda K, Ishizawa S, Sato M, Yoshida T & Shibahara S...

Ngày tải lên: 19/02/2014, 06:20

12 622 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... component of the amyloid plaques in AD brain [42,43], global AD research focused on this peptide as a causative agent in the disease The 39–43 amino acid cleavage product of the Ab A4 precursor ... down-regulated by decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab...

Ngày tải lên: 07/03/2014, 10:20

9 634 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... Primers with the following sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox ... acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower ... horizontal transfer of vitamin C-related genes In the process of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form...

Ngày tải lên: 07/03/2014, 12:20

11 571 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

... suggests that C paradoxa PsbU has a higher homology with the red algal protein than with the cyanobacterial one The C paradoxa thylakoid membranes also contained a band cross-reacted with anti-(R-PsbQ¢), ... Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride ... optimizing the availability of Ca2+ and Cl– cofactors for water oxidation in the green lineage In fact, all of the thylakoid membranes from diatoms (C gracilis and P tricornutum), a haptophyte (P gyrans)...

Ngày tải lên: 23/03/2014, 15:21

11 503 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

... wave  breaking  on  a natural  beach  To  verify  the accuracy  of the numerical  model  on  the simulation  of the wave  transformation  on  a natural  beach,  existing  experimental data on the wave dynamics in  ... suitable  for a practical  application.  On  the other hand, based on results of Nadaoka et al  [9], Ting and Kirby [15‐17], it can be estimated  that  in  the surf  zone,  the time  scale  ... when  waves  are  breaking,  a major  part  of the lost  wave  energy  is  dissipated  directly  in  the shear layer beneath the surface roller, and only  a minor part of it is transformed into turbulent ...

Ngày tải lên: 28/03/2014, 15:20

11 460 0
a research agenda for dsm-v

a research agenda for dsm-v

... stimulate research that would enrich the empirical database before the start of the DSM-V revision process and 2) to devise a research and analytic agenda that would facilitate the integration of findings ... the many categories within the main part of the manual Should DSM-V contain a rating of the quality and quantity of information available to support the different diagnostic systems? The advantage ... Department of Veterans Affairs Medical Center, Atlanta, Georgia Margarita Alegria, Ph.D Professor of Health Services Administration; Director of the Center for Evaluation and Sociomedical Research, ...

Ngày tải lên: 10/04/2014, 10:57

332 403 0
a novel method for the synthesis of titania nanotubes using

a novel method for the synthesis of titania nanotubes using

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al /...

Ngày tải lên: 05/05/2014, 15:26

8 634 0
a novel method for the synthesis of cao nanoparticle

a novel method for the synthesis of cao nanoparticle

... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, ... capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15­ agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... enhanced reactivity tension These substances also control both towards the toxicants makes them the potential the reduction rate of metal ions and the materials for the decomposition applications agglomeration...

Ngày tải lên: 06/05/2014, 08:55

12 705 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

... purposed the assessment of the migration capacity of the cells At the moment there is no consensus in establishing acceptance criteria for the migration capacity of BM-MNC in cardiac regeneration ... invalid value, based on acceptance criteria, was observed in the first run for the 1:10 dilution The results of the validation assay are reported in Table Page of (page number not for citation ... and coordination All the authors read and approved the final manuscript References Regulation (EC) No 1394/2007 of the European Parliament and of the Council of 13 November 2007 on advanced therapy...

Ngày tải lên: 18/06/2014, 15:20

9 775 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic...

Ngày tải lên: 18/06/2014, 16:20

12 574 0
Báo cáo sinh học: " A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

Báo cáo sinh học: " A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

... collection and assembly of data, performed data analysis, did the visual evaluation of all dot plots and wrote parts of the manuscript LP coordinated the collection and assembly of data, did all statistical ... scientific aspects, data analysis and interpretation as well as manuscript writing and approval All authors read and approved the final manuscript The members of the CRI-CIC Assay Working group critically ... revealed a clear benefit for the use of a DUMP channel, extending the observations from the initial proficiency panels The benefit for applying dump channel strategies was apparent in a large fraction...

Ngày tải lên: 18/06/2014, 22:20

13 752 0
w