determining the position of a pattern within a string

... be applied for other porous materials with the grain diameter of 0.1-0.6 mm (ii) The filling height of sand samples and the immersion depth of the capillary tube at the initial state had a great ... Variations of the hydraulic permeability with the diameter of sand grains Figure plots the relationship between the capillary equilibrium height and the reciprocal of the grain diameter It can ... amount of test samples The present method can provide an important basis for analyzing the heat transfer process of BHEs in a sand-based aquifer, and also be applied for other porous materials with...

Ngày tải lên: 05/09/2013, 17:03

... Tools Data Access Data Storage Security After completing the above steps, you will discuss your responses with the class The instructor will write the class consensus on a flipchart THIS PAGE INTENTIONALLY ... Determining the Impact of Technology on a Windows DNA Design 51 Write your answers in the table below User Interface User Services Business Services Data Access Data Store Communication Operating Systems ... Activity 7.2: Determining the Impact of Technology on a Windows DNA Design Exercise 1: Determining Technology Implications ! Determine technology implications Participate in small groups as assigned...

Ngày tải lên: 21/12/2013, 06:16

... // Add table mappings da.TableMappings.Add("Table", "Orders"); da.TableMappings.Add("Table1", "Order Details"); // Create the DataSet DataSet ds = new DataSet( ); // Fill the schema and data da.FillSchema(ds, ... Online The GetSchemaTable( ) method of the DataReader also returns all column lengths The method returns a DataTable containing column metadata for a DataReader, where the ColumnSize column contains ... iterates over the collection of columns in the table and displays the length, precision, and scale for each from the Hashtable Information from the FillSchema( ) method of the DataAdapter is also...

Ngày tải lên: 24/12/2013, 05:15

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...

Ngày tải lên: 21/02/2014, 01:21

... National Association of Child Care Resource and Referral Agencies (NACCRRA), the National Association for the Education of Young Children (NAEYC), and the National Head Start Association (NHSA), ... standards for the quality of school meals and all food sold in school, as well as a number of other important criteria As part of the First Lady’s Let’s Move campaign, the Administration is actively ... the American Medical Association (AMA), HHS’s Health Resources and Services Administration (HRSA), and the CDC, made recommendations, which have been endorsed by the American Academy of Pediatrics...

Ngày tải lên: 14/03/2014, 09:20

... (5¢-GACCTGGAAGAAATACGATTTAGAATGG-3¢) and the Anchor Primer from the kit, and consisted of 30 cycles of at 94 °C, at 55 °C and at 72 °C A 600-bp amplification product was obtained 5¢ RACE-PCR Amplification ... be the start of the protein coding domain Sequence analysis of the 3¢ end cDNA revealed that there is a polyadenylation signal upstream of the poly (A) Analysis of the primary structure of M brassicae ... trichodea) are located on the lateral part of the ventral area and are arrayed in four to five parallel rows [32] (Fig 4A, white arrows) Short sensilla trichodea are located medio-ventrally and are...

Ngày tải lên: 17/03/2014, 23:20

... Spanish, Polish, German and Italian) We anticipated that most of these journal editors would either speak English as a second language or have access to a translator Non-respondents were approached ... are male, over 40 years of age and speak English There is an over-representation of UK and US based publications in the literature which increases the risk of language bias in the orthopaedic ... this is an area that would benefit from further study A study of the natural history of peer reviewers has found that the majority of peer reviewers deteriorated over time at a gradual rate but...

Ngày tải lên: 20/06/2014, 04:20

... Spanish, Polish, German and Italian) We anticipated that most of these journal editors would either speak English as a second language or have access to a translator Non-respondents were approached ... are male, over 40 years of age and speak English There is an over-representation of UK and US based publications in the literature which increases the risk of language bias in the orthopaedic ... this is an area that would benefit from further study A study of the natural history of peer reviewers has found that the majority of peer reviewers deteriorated over time at a gradual rate but...

Ngày tải lên: 20/06/2014, 07:20

... compare categorical data A mixed models analysis was employed using SAS Systems A repeated-measures ANOVA was used, where the year was regarded as the repeated measure and the factor was the variable ... before dispatching them It is suggested that in the case of neonatal and maternity incidents, the fact that these patients are already accommodated at a health facility has led many dispatchers ... that same year Neonatal transfers therefore spent longer in a particular status category than in any of the other categories This trend was seen in all but one of the status categories (mean...

Ngày tải lên: 21/06/2014, 03:20

... related to one another in just the same way as the genera of a family, and the groups themselves as the families of an order, or the orders of a class; while all have the same sort of structural ... of the other subkingdoms For similar reasons men and horses are arranged as members of the same Class, 'Mammalia'; men and apes as members of the same Order, 'Primates'; and if there were any animals ... you have reason to believe there has also been a great lapse of time or a great change of conditions The animals, for instance, of the newest tertiary rocks, in any part of the world, are always,...

Ngày tải lên: 28/06/2014, 19:20

... change mean curve (AGCm curve) was based on annual values and was the mean of all AGC single values of all bog pines of the transect, using the median percentage values (for the reduction class ... were taken), whereas small trees and saplings were cut and sliced at their root collar This material was prepared in the laboratory to obtain information on the age of each tree and to allow the ... range, mean annual precipitation is about 1500 mm with a peak in summer Mean annual temperature is about 5.5 °C; the mean of the coldest month (January) is ca –4 °C, and the mean of the warmest...

Ngày tải lên: 08/08/2014, 01:21

... Richards EJ: Natural variation in DNA methylation in ribosomal RNA genes of Arabidopsis thaliana BMC Plant Biol 2008, 8:92 38 Miura A, Nakamura M, Inagaki S, Kobayashi A, Saze H, Kakutani T: An Arabidopsis ... software [46] (http://katahdin.mssm.edu/kismeth/revpage.pl) was used to analyse the methylation data Once the data for each site were gathered, GraphPad software was used for statistical analysis ... 5’-CTTTTTTCTCATAATACTCATAA-3’ For the second reaction, a forward primer, internal to the first one, was used, as follows: forward 5’-GGAGGAGGAGAAA TATTATTATT-3’ As a reverse primer, the same one was used...

Ngày tải lên: 11/08/2014, 11:20

... discuss? A The architecture of early America Indian buildings B The movement of American Indians across North America C Ceremonies and rituals of American Indians D The way of life of American Indian ... questions wandered the dry and mountainous lands between the Rocky Mountains and the Pacific Ocean They gathered seeds and hunted small animals such as rabbits and snakes In the Far North, the ancestors ... following animals was most important to the Plains Indians? A The salmon B The caribou C The seal D The buffalo Question 80 Which of the following is NOT mentioned by the author as a dwelling place of...

Ngày tải lên: 08/10/2014, 16:46

... by the weather A Because of the bad weather, our excursion to London was put off later B Our plans for an excursion to London have fallen through because the weather was so bad C The bad weather ... enough, so he failed in the exam A The reason why he failed in the exam was that he didn’t work hard enough B The reason he failed in the exam was because he didn’t work hard enough C The reason for ... weather was the reason that made our excursion to London have been fallen over D Our plans for an excursion have fallen away because the weather was bad Question 44 : Everyone started complaining the...

Ngày tải lên: 08/10/2014, 16:46

... to ask whether because of the use of hand skills, manual pattern cutting was a craft and was pattern making still a craft if patterns were produced using digitisation? Dormer would argue that the ... producing garment patterns Data was gathered from the 2D patterns and the garments made from the patterns through a number of fixed measurements This data alone was insufficient in demonstrating the ... interpretation of a 2D sketch into a reality and qualitative data was required When analysing the patterns and the garments, data relied X upon professional judgement from the researcher as the designer...

Ngày tải lên: 15/08/2015, 01:53

... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... copied) data in a message • Data manager backs its own data Deadlock may occur if a data manager becomes blocked in a page fault waiting for data which it provides Fortunately, there are several techniques...

Ngày tải lên: 12/09/2012, 15:05

... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...

Ngày tải lên: 13/09/2012, 10:52

... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... within the Old World Thereafter sub-Saharan Africa occupied a unique position of partial isolation It was more isolated than Eurasian fringes like Scandinavia or South-East Asia, which gradually adopted...

Ngày tải lên: 21/09/2012, 10:39

... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...

Ngày tải lên: 02/10/2012, 12:07

... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... G, Markogiannakis A, Papaparaskevas J, Daikos GL, Stefanakos G, Zissis NP, Avlamis A Differences in the changes in resistance patterns to third- and fourth-generation cephalosporins and piperacillin/tazobactam...

Ngày tải lên: 25/10/2012, 11:00