determinants of increased benefit from chemotherapy

lin and liu - 2009 - the determinants of auditor switching from the perspective of corporate governance in china

lin and liu - 2009 - the determinants of auditor switching from the perspective of corporate governance in china

... THE DETERMINANTS OF AUDITOR SWITCHING FROM THE PERSPECTIVE OF CORPORATE GOVERNANCE IN CHINA costs of raising capital and hiring a low-quality auditor to maintain the gains from the opaqueness of ... market An investigation of the determinants of auditor switching from the perspective of corporate governance should contribute to an understanding of the necessity and utility of independent audits ... investors to evaluate the cost of capital of the company, as described by the results of a survey of members of the American Institute Volume 17 Number July 2009 of Certified Public Accountants...

Ngày tải lên: 06/01/2015, 19:43

16 325 0
lin and liu - 2010 - the determinants of auditor switching from the perspective of corporate governance in china

lin and liu - 2010 - the determinants of auditor switching from the perspective of corporate governance in china

... on the utility of the auditing function as well as the consequences of auditor switching in the Chinese context To study the determinants of auditor switching from the perspective of corporate ... owner's shareholding as a percentage of total shares number of members of the supervisory board if the CEO also holds the position of Chairman of the Board of Directors; otherwise GOV if the largest ... auditing firms, thus the firms may benefit from lower costs in capital raising from the equity or debt market or from the reduction of agency costs in the enforcement of contractual obligations On the...

Ngày tải lên: 06/01/2015, 19:43

11 586 0
Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx

Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx

... inactivation of the dimeric almond b-glucosidase was not a result of unfolding, dissociation or aggregation of the intact enzyme [16] P (MPa) Fig Influence of pressure on the enzyme activity (A70 ⁄ A0) of ... varies from 5.6 to 6.3 in the pressure–temperature plane of measurements for the inactivation studies when starting with a buffer of pH 6.0 at ambient conditions (for a graph of the pH of Mes ... chemical composition of the protein solution (pH, salts) will also influence the stability of the enzyme In particular, the effect of pH is also considered here, as the pH of the solvent is both...

Ngày tải lên: 07/03/2014, 03:20

9 341 0
Báo cáo khoa học: Structures of type B ribose 5-phosphate isomerase from Trypanosoma cruzi shed light on the determinants of sugar specificity in the structural family ppt

Báo cáo khoa học: Structures of type B ribose 5-phosphate isomerase from Trypanosoma cruzi shed light on the determinants of sugar specificity in the structural family ppt

... concentration of Allu6P after derivatization [13] Isomerization of this 6-carbon sugar could not be detected, even when it was added at a concentration of 30 mm The same preparation of TcRpiB had a kcat of ... Some of these compounds inhibit MtRpiB [13] The difference in the behaviour of the two enzymes appears to arise from the slightly broader active site in MtRpiB as a result of the switch of the ... using the 806 software sod [33], which was placed at the position of the molecular replacement solution From this starting point, the software arp ⁄ warp [34] was used to auto-build 99% of the structure,...

Ngày tải lên: 15/03/2014, 00:20

16 402 0
The Determinants of Bank Net Interest Margin: Evidence from the Lebanese Banking Sector ppt

The Determinants of Bank Net Interest Margin: Evidence from the Lebanese Banking Sector ppt

... favour of the Lebanese Pound has brought the level of dollarization of (resident private sector) loans from 87.01% at the beginning of 2001 to 77.28% at the end of 2010, and the dollarization of ... maximum of 14.83% in 2009, with an overall average of 11.77% The liquidity of these banks recorded a minimum of 62.43% in 2001, and a maximum of 71.36% in 2008, with an overall average of 66.58% ... 20.83% in 2007 and a maximum of 31.53% in 2001, with an overall average of 27% Finally, the credit risk of these banks increased significantly, where LLP increased from 17.06% in 1996 to 26.82%...

Ngày tải lên: 22/03/2014, 17:20

14 763 1
DETERMINANTS OF COMMERCIAL BANKS INTEREST RATE SPREADS: SOME EMPIRICAL EVIDENCE FROM THE EASTERN CARIBBEAN CURRENCY UNION pdf

DETERMINANTS OF COMMERCIAL BANKS INTEREST RATE SPREADS: SOME EMPIRICAL EVIDENCE FROM THE EASTERN CARIBBEAN CURRENCY UNION pdf

... purpose of this study is to provide an econometric account of some of the main determinants of the ex-post interest rate spreads of commercial banks The paper uses pooled annual data of all the ... spread and a widening of those of the indigenous banks This could have been as a result of the entry of Trinidadian banks to the banking system Tables 3A and 3B show the magnitude of the spread in ... T., P Lhacer and M Nakane, 2001, “The Determinants of Bank Interest Spreads in Brazil,” Joint Research of the Central Bank of Brazil and the University of Sao Paulo Barajas, A., R Steiner and...

Ngày tải lên: 22/03/2014, 23:20

35 447 0
EPA Has Improved Its Review of Effluent Guidelines but Could Benefit from More Information on Treatment Technologies doc

EPA Has Improved Its Review of Effluent Guidelines but Could Benefit from More Information on Treatment Technologies doc

... including these 22 individuals from February 2012 to April 2012 Six of these interviews were with officials from industry, from academia, from state and local government, and from nongovernmental organizations ... interviewed officials from EPA’s Office of Enforcement and Compliance Assurance to learn about the management of the databases that store discharge monitoring data We also interviewed officials from ... from a list of approximately 50 individuals identified from a variety of sources, including referrals from EPA, the Association of Clean Water Agencies, the National Association of Clean Water...

Ngày tải lên: 23/03/2014, 00:20

72 335 0
Determinants of the interest rate pass-through of banks − evidence from German loan products pptx

Determinants of the interest rate pass-through of banks − evidence from German loan products pptx

... University of Cologne, Department of Banking Sönke Sievers (sievers@wiso.uni-koeln.de) is with the University of Cologne, Accounting Area This paper has benefited from the comments of research ... index.………………………………………………………………………… 55 Determinants of the interest rate pass-through of banks í Evidence from German loan products1 Introduction In the German bank-based economy the loan rate-setting behavior of banks is ... bank borrowers benefit from the ability of a bank to operate cost efficiently The literature concerning the interest rate-setting behavior of banks assumes that at least a portion of cost efficiency...

Ngày tải lên: 29/03/2014, 13:20

72 347 0
Báo cáo khoa học: Probing the determinants of substrate specificity of a feruloyl esterase, AnFaeA, from Aspergillus niger doc

Báo cáo khoa học: Probing the determinants of substrate specificity of a feruloyl esterase, AnFaeA, from Aspergillus niger doc

... carbohydrates [7] The hydrophobic patch of a sugar moiety, resulting from the disposition of the equatorial and axial hydroxyls to one side of the pyranose ring of a sugar monomer, aligns itself upon ... face of the amino acid to contribute to selectivity of fit of the substrate to the binding site of the enzyme [8] Tryptophan has been shown to be essential for substrate binding in most of the ... direct extrapolation of the position of the oxyanion pocket Crystallography and point replacement of the nucleophilic serine of AnFaeA, Ser133, allowed the identification of the active site, confined...

Ngày tải lên: 30/03/2014, 20:20

10 382 1
Báo cáo lâm nghiệp: "Botanical determinants of foliage clumping and light interception in two-year-old coppice poplar canopies: assessment from 3-D plant mock-ups" ppsx

Báo cáo lâm nghiệp: "Botanical determinants of foliage clumping and light interception in two-year-old coppice poplar canopies: assessment from 3-D plant mock-ups" ppsx

... consists of 10 northsouth oriented rows of 10 plants each with alternating inter-row distances of 0.75 m and 1.5 m, and a within row spacing of 0.9 m, to yield a planting density of plant m−2 From ... (wL /lL ) was set from a value of 0.809 to 2, 0.593, or 0.2 for Gho and from a value of 0.593 to 2, 0.809, or 0.2 for Tri – ? ? + [25] units are themselves defined as a collection of elementary units ... increase of about 3% in DMA1+A2 for a decrease of about 6% in the level of light intercepted by its vegetation was found when the same scenario was applied to Gho DISCUSSION 4.1 Determinants of light...

Ngày tải lên: 07/08/2014, 16:21

10 275 0
Báo cáo khoa học: "PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases" doc

Báo cáo khoa học: "PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases" doc

... :drawrof CGAAATCAAGCAGTTCCGAACGCA :esrever TTGGCATAGTGGTAGTTAGC :drawrof TACAGCAATTTGGACCAC :esrever AAGGAGAAAACCACGAAC :drawrof CTCCTTCTGTTGTTGTTCGG :esrever GCGTCGTAAACGTCGTCCAC :drawrof CGTAGCTTGTTAGCCTTCG ... detatipicerp saw AND )1 : 42( lohocla lymaosi :mroforolhc dna )1 : 1( mroforolhc :lonehp htiw noitcartxe yb deifirup saw AND Co56 ta nim 03 rof detabucni dna )lCaN M 7.0 ni edimorb muinomma lyhtemirt ... GCGTCGTAAACGTCGTCCAC :drawrof CGTAGCTTGTTAGCCTTCG :esrever GGACATGGTCGTAGAGATA :drawrof CGAAT ATAACTGGGACTTTT :esrever GGATGTTCGTGACTTCGG :drawrof )'3-'5( ecneuqeS aps aps A tne cun )noiger-X( aps )gnidnib-GgI(...

Ngày tải lên: 07/08/2014, 20:23

4 138 0
Báo cáo y học: " Protocol for investigating genetic determinants of posttraumatic stress disorder in women from the Nurses'''' Health Study II" pot

Báo cáo y học: " Protocol for investigating genetic determinants of posttraumatic stress disorder in women from the Nurses'''' Health Study II" pot

... to classify PTSD cases with a sensitivity of 85%, specificity of 93%, positive predictive value of 68%, and negative predictive value of 98% The cutoff point is optimized for two-stage designs ... phone numbers from their survey, we have telephone numbers for over 62,000 of the study members and can access numbers for most of the rest of the cohort by sending a computer tape of names and ... Thus, it is to be expected that some of the genetic variants associated with increased risk of developing PTSD would also be associated with increased risk of other mental disorders Rather than...

Ngày tải lên: 11/08/2014, 17:20

20 326 0
DETERMINANTS OF BANKS’ PROFITABILITY IN a DEVELOPING ECONOMY, EVIDENCE FROM NIGERIA

DETERMINANTS OF BANKS’ PROFITABILITY IN a DEVELOPING ECONOMY, EVIDENCE FROM NIGERIA

... Macroeconomic Determinants of Bank Profitability Bank of Greece Working Paper 25 Available at: http://www.bankofgreece.gr/BogEkdoseis/Paper200525.pdf Babalola, Y A (2012) The Determinants of Bank’s Profitability ... (2012) Determinants of Bank’s Profitability: Evidence from Bangladesh Indian Journal of Finance, 6(2), 32 – 38 Khrawish, H A (2011) Determinants of Commercial Banks Performance: Evidence from Jordan ... bank-specific determinants, with the exception of size, affect bank profitability significantly in the anticipated way Saona (2011) examined the determinants of the profitability of the US banks...

Ngày tải lên: 30/10/2014, 09:02

15 648 2
lei - determinants of cg and the link between cg and performance - evidence from the uk using a corporate governance scorecard

lei - determinants of cg and the link between cg and performance - evidence from the uk using a corporate governance scorecard

... 6: Number of observations by fiscal year No of firms No of firms in previous year No of firms in both current and previous years No of new firms Mean score of new firms Mean score of firms in ... to shareholders of remuneration of executive directors; (9) disclosure is made to shareholders of remuneration of non-executive directors; (10) disclosure is made of components of remuneration ... result from investors valuing the same earnings (or dividends) more highly Tables 16 and 17 indicate the association of SCORE with a set of profitability variables OLS regressions of the profitability...

Ngày tải lên: 06/01/2015, 19:48

100 321 0
Tiểu luận quản trị rủi ro Determinants of corporate  hedging decision Evidence  from Croatian  and  Slovenian companies

Tiểu luận quản trị rủi ro Determinants of corporate hedging decision Evidence from Croatian and Slovenian companies

... Determinants of corporate hedging decision: Evidence from Croatian and Slovenian companies nghiệp Slovenia liên quan đến công ... giá trị công ty hàm mục tiêu lõm bất hoàn hảo thị trường vốn Trang / 29 Determinants of corporate hedging decision: Evidence from Croatian and Slovenian companies - Lập luận cho thấy rằng, cách ... (1999) Haushalter et al (2002) hỗ trợ lý phòng ngừa rủi ro Trang / 29 Determinants of corporate hedging decision: Evidence from Croatian and Slovenian companies - - Một lý luận khác tập trung...

Ngày tải lên: 22/04/2015, 13:49

29 461 0
How companies benefit from the internet of things    in 3 charts

How companies benefit from the internet of things in 3 charts

... placed hundreds of wireless sensors across 24 of its data centers The result has been an electricity decrease of 55 million kWh annually, and a reduction of 66 million pounds of greenhouse gases ... says one of the key drivers of IoT value is cost reductions Cisco estimates that $19 trillion will be created from IoT profits and cost savings over the next decade Unfortunately, 73% of companies ... will benefit from the Internet of Things (IoT) There’s a lot at stake for companies too A survey by Accenture shows that top-level executives and CEO’s believe the IoT brings three main benefits...

Ngày tải lên: 09/07/2015, 18:31

31 438 0
Tiểu luận quản trị rủi ro Determinants of corporate hedging decision Evidence from Croatian and Slovenian companies

Tiểu luận quản trị rủi ro Determinants of corporate hedging decision Evidence from Croatian and Slovenian companies

... Sevic, Determinants of corporate hedging decision: Evidence from Croatian and Slovenian companies”, Research in Internation Bussiness and Finance, 2012 41 Ying Liu, “The Determinants of Corporate ... hedging policies, The Journal of Financial and Quantitative Analysis 19 (2), 127–140, 1984 ****Smith, C.W., Stulz, R.M, The determinants of firm hedging policies, Journal of Financial and Quantitative ... Empirical Research of European Firms”, Tilburg University, 2014 Haushalter, G.D., Financing policy, basis risk, and corporate hedging: Evidence from oil and gas producers The Journal of Finance 55...

Ngày tải lên: 14/07/2015, 14:25

42 435 0
Determinants of dividend payout ratio evidence from listed companies on ho chi minh stock market

Determinants of dividend payout ratio evidence from listed companies on ho chi minh stock market

... degree of profitability as one of 28 the most critical determinants that might affect firms’ dividend decisions Profitability can be described as the ability of the firm to make a profit The size of ... DETERMINANTS OF DIVIDEND PAYOUT RATIOS: EVIDENCE FROM LISTED COMPANIES ON HO CHI MINH STOCK MARKET In Partial Fulfillment of the Requirements of the Degree of MASTER OF BUSINESS ADMINISTRATION ... for a variety of considerations of significance to management, particularly those of future investments and attraction of new equity capital 4 Dividend, because of its nature of cash disbursement,...

Ngày tải lên: 22/10/2015, 13:17

88 937 0
Removal of congo red from wastewater by adsorption onto waste red mud

Removal of congo red from wastewater by adsorption onto waste red mud

... initial with stages lapse of of time 90 uptake for all the dye of dye decreased concentrations curves monolayer increased from were single, smooth coverage of on dye and outer of adsorbent 20 40 60 ... Fe(III)/Cr(III) Namasivayam of dairy (11) and coworkers from employed solutions of using containing congo fly ash and coal(g) et al (12) have of nickel of this a textile such of chlorophenol study ... samples varied from no change the data were for of the effect dye after Langmuir taken from and batch of agitation dose in absorbance removal and adsorbent desorption adsorption of 10 mg/L greater...

Ngày tải lên: 23/09/2012, 14:47

17 897 1
Monitoring the macroeconomic determinants of banking system stability

Monitoring the macroeconomic determinants of banking system stability

... Figure Indicators of financial soundness of companies 100 1.1 Development of the financing structure of Belgian companies (percentages of total) 16 1.2 Indicators of the profitability of Belgian companies ... direction of the analyses by studying to what extent macroeconomic developments of a real nature can affect the stability of the financial system Theoretical outline of the determinants of financial ... sufficiently profitable This substantial degree of profitability is generally coupled with an increased risk profile On the other hand, the most reliable borrowers are the victims of obvious discrimination...

Ngày tải lên: 24/10/2012, 09:11

21 593 1
w