detailed design of a plate heat exchanger

... Not a2 [19 18] a2 [19 0] GND a2 [17 0] Datab[] Dataa[] Cin ParADD1 Cin Datab[] Cin Dataa[] q[] Cout SM[19 0] Output Cout Result[] LPM ADD SUB ParADD1 Datab[] Result[] LPM ADD SUB Dataa[] OutREG ... SCI has no latency [17] The arithmetic units are realized by using combinational logic, meaning that all calculation operations are performed in parallel The schematic diagram of its FPGA ... These abilities represent the major advantages of multicycle design and they help reduce both hardware complexity and cost. The designed hardware is suitable for a wide range of applications, because

Ngày tải lên: 22/06/2014, 23:20

... possibilities of data flow organization (and design of a memory hierarchy between background frame memories and data paths of the video processor) exist enabling also vertical window over- lapping (not ... the paper. It is based on a nonlinear rational filter enhanced by a noise estimator for blind and dynamic adaptation of the filtering parameters to the input signal statistics. The VLSI filter features ... Sergio S aponara Department of Information Engineering, University of Pisa, Via Caruso, 56122 Pisa, Italy Email: sergio.saponara@iet.unipi.it Luca Fanucci Institute of Electronics, Information Engineering

Ngày tải lên: 23/06/2014, 01:20

... bus and uses 6 output ports and 3 input ports for communication. address name 7 6 5 4 3 2 1 0 000 ADDR0 A7 A6 A5 A4 A3 A2 A1 A0 001 ADDR1 A15 A14 A13 A12 A11 A10 A9 A8 010 ADDR2 A23 ... 1: VGA and PS/2 interface Address R W 0000 - ADDR0 0001 - ADDR1 0010 - ADDR2 0100 DATA0 DATA0 0101 DATA1 DATA1 0111 STATUS COMMAND 1000 - OPAQUECOLOR 1001 - ALPHA1A 1010 ALPHA1B ... images: OpaqueColor=”11111111” (white) Alpha1a=”0101” (on non-opaque spot, the opacity of first layer is 62,5%) Alpha1a Alpha2a Alpha1b X Opaq col 0 X + 1 = 3 3 4 4 Alpha1b=”1000”

Ngày tải lên: 27/06/2014, 00:20

... ACA ATA AAG ATA GGG GGG CAA TTA AAG GAA GCT CTA TTA GAT T 3', 5' CCG GAA TCT AAT AGA GCT TCC TTT AAT TGC CCC CCT ATC TTT ATT GTG ACG A 3', 5' GGG GTC GCT GCC AAA GAG TGA TCT GAG GGA AGC TAA AGG ... portion of PR and to create a stop at the end of PR are 5' GAA GAT CTA CGC GTT CCG GAG CAG ATG ATA CAG TAT TAG AAG 3' and 5' CGG AAT TCG GAT CCT TAA AAA TTT AAA GTG CAG CCA ATC TGA GT 3' Cells Human ... create a 463 bp fragment containing PR with a stop and EcoRI site The primers used for PCR are 5' GGG AAG ATC TGG CCT TCC CAC 3' and 5' CGG AAT TCG GAT CCT TAA AAA TTT AAA GTG CAG CCA ATC TGA

Ngày tải lên: 13/08/2014, 06:20

... using MathCAD software (Mathsoft Inc., Waltham, MA, USA) at PCCR to obtain the following parameters : (1) maximum ranges of motion in the sagittal, coronal, and axial planes and (2) average velocities ... sagittal, coronal, and axial planes from neutral to end ranges. Standing Postural Sway Postural sway data are collected using a method and protocol developed by Bhattacharya et al [85] and adapted ... Open Access Chiropractic and self-care for back-related leg pain: design of a randomized clinical trial Craig A Schulz 1* , Maria A Hondras 2 , Roni L Evans 1 , Maruti R Gudavalli 2 , Cynthia R

Ngày tải lên: 13/08/2014, 15:21

... lauravannucci@biomed.unipi.it; Alessia Ravani - alessiaravani@biomed.unipi.it; Francesca Bonci - f.bonci@kedrion.com; Flavia Chiuppesi - flo83@email.it; Barbara Del Santo - barbaradelsanto@biomed.unipi.it; ... vector for transducing ex vivo dendritic cells and T lymphocytes Mauro Pistello*, Laura Vannucci, Alessia Ravani, Francesca Bonci, Flavia Chiuppesi, Barbara Del Santo, Giulia Freer and Mauro Bendinelli ... Inactivation of LTR mediated transcrip- tion was ascertained by amplifying cDNA of transduced cells with INs and RREas primers (Fig. 3C). Reverse tran- scription was carried out with an avian

Ngày tải lên: 14/08/2014, 19:22

... indicates that the designed airfoils have a maximum aerodynamic efficiency lower than that of the S809’s, however they have larger values for a larger range of the angles of attack This is a possible ... that the angles of attack in the airfoils go from around degrees to around 22 This indicates that instead of a maximization of the Cl /Cd of the airfoil for a given alphadesign, the optimization ... degrees to around 22 This indicates that instead of a maximization of the Cl /Cd of the airfoil for a given alphadesign, the optimization should be implemented for a range of angles of attack which

Ngày tải lên: 09/09/2015, 10:17

... targeting at the Main profile of H.264/AVC standard, it can be easily scaled to the High profiles of the standard, because of very similar implementation schemes and design architectures of Main profile ... CABAC decoder and CAVLC codec of H.264/AVC and statistical (entropy) codec design of JPEG2000, or other similar data processing codec designs Although the proposed CABAC encoder is designed targeting ... nature of CABAC with strong data dependency and frequent memory access, it is not efficient to accelerate CABAC encoding by software optimization Therefore, hardware acceleration of CABAC encoding

Ngày tải lên: 10/09/2015, 15:50

... effect of carbon and boron on the activity of a Ni catalyst”, accepted 7. Kong Fei Tan, Jing Xu, Armando Borgna, Mark Saeys, “First principles based design of a Fisher-Tropsch synthesis catalyst ... surface Carbon atoms are represented by smaller balls and Ni atoms are represented larger balls Left panel, 50% carbon... energies are relative to CH4 and H2O in the gas phase and calculated ... preferred adsorption sites for carbon atoms and can act as nucleation sites for the formation of graphene islands. On-surface carbon atoms are relatively unstable with binding energies of around

Ngày tải lên: 11/09/2015, 16:06

... chemical processes of natural gas activation, such as steam reforming (SR) and catalytic partial oxidation (CPO) of natural gas (Twigg, 1996; Ponec and Bond, 1995). Natural gas is gaining importance ... content makes methane a particularly interesting raw material. Chemisorption and activation of methane on Ni catalysts is of considerable importance because SR and CPO of methane to produce syngas ... Models of catalytic surface The choice of an appropriate model to represent a catalytic surface or active site is important as it can have significant effects on the accuracy of results. Cluster calculations

Ngày tải lên: 11/09/2015, 16:06

... using directional antennas By making efficient use of directional antennas, for both transmission and reception, and spatial reuse in transmission, Achilles achieves the goal of a high capacity mesh ... representation of antenna radiation pattern of a directional and omnidirectional antenna 2.2 Azimuth pattern showing the dB beamwidth 2.3 Block diagram of a ... ACHILLES: DESIGN OF A HIGH CAPACITY MESH NETWORK WITH DIRECTIONAL ANTENNAS SUKANTA KUMAR HAZRA (B.Eng (Hons.) NUS) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF

Ngày tải lên: 26/09/2015, 10:51

... high gain comparator which has a small delay will in general result in a smaller output ripple voltage and a more accurate output. There are many ways to realize a comparator and using an amplifier ... 75dB and has a phase margin of more than 80 degrees typically. And it has a worst case phase margin of about 64 degrees. Also the 3dB frequency attained is close to the value calculated earlier. - - – – - - 5-9: ... have a large closed-loop bandwidth or to use a large output capacitor at its output. LDO regulators incorporating a small output capacitor typically have a dominant pole at one of the internal

Ngày tải lên: 04/10/2015, 15:44

... DESIGN OF A BROAD-BAND DISTRIBUTED AMPLIFIER AND DESIGN OF CMOS PASSIVE AND ACTIVE FILTERS DALPATADU K. RADIKE SAMANTHA Beng (Hons), NUS NATIONAL UNIVERSITY OF SINGAPORE 2011 DESIGN OF A ... Conversion Channel Selection Frequency Conversion Channel Selection Analog A/D Digital Analog A/D Digital Analog A/D Digital Analog A/D Digital Software Digital Filtering Analog Filtering a) ... S – parameters of the amplifier are obtained by using ABCD parameters as shown below. (4.5) Where, At is the ABCD parameters of the measured attenuators A0 is the ABCD parameters of the Amplifier A1

Ngày tải lên: 12/10/2015, 17:34

... challenges for small scale and micro-fuel cells in terms of design, materials, effective transport of reactants, and heat management The development of physically representative models that allow ... performance and design of air-breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one-dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air-breathing ... However, these fuel cell designs have generally relied on traditional planar MEA architecture Because the majority of PEM fuel cell designs are based on planar plate and frame architecture, their...

Ngày tải lên: 05/09/2013, 14:58

... distribution patterns of activation overpotentials are similar, with higher values at the catalyst layer near the air inlet area It can be seen that the activation overpotential profile correlates with ... performance and design of air-breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one-dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air-breathing ... However, these fuel cell designs have generally relied on traditional planar MEA architecture Because the majority of PEM fuel cell designs are based on planar plate and frame architecture, their...

Ngày tải lên: 05/09/2013, 14:58

... / F1 and FT = F1 + F2 Here, the total heat transfer surface area FT of the two heat exchangers is assumed to be a constant (3) There is a constant rate of heat leakage ( q ) from the heat source ... transfer coefficient and F2 is the total heat transfer surface area of the cold-side heat exchanger Here the & &′ imaginary part n2 of n indicates the relaxation of a heat transfer process Defining ... i is a complex heat transfer exponent, k1 is the overall heat transfer coefficient and F1 is the total heat transfer surface area of the hot-side heat exchanger, k2 is the overall heat transfer...

Ngày tải lên: 05/09/2013, 16:10

... –First packet in any transaction –Specifies function address, endpoint –Specifies data direction ? Data - DATA0, DATA1 –0 - 1023 bytes ? Handshake - ACK, NAK, STALL –Report status of data transaction ... Driver USB Host Data Packet IN Token Data Packet Data Buffer ACK Data Packet IN Token Data Packet ACK 36 18 Control Read ? Call USBRead( EP0 ) to read a Setup Packet USBRead( –Read from EP0 OUT ... Idle Handshake ACK ACK DATA0/ DATA0/ DATA1 DATA1 NAK DATA0 T/O STALL T/O ACK Idle Host Function There are Four Types of USB Transactions ? Isochronous (Audio, telephony …) –Periodic, Bounded latencies,...

Ngày tải lên: 13/12/2013, 00:15

... to ground, neutral to live and neutral to ground Neutral to ground has the advantage of safety, but also the disadvantage of the fact that neutral is usually grounded at the transformer, so no ... can be truly reliable One way of reducing the message transmission rate is to introduce ample redundancy into the data stream Extra bits are placed into each data word and are used to detect and ... basic limitation that noise causes in a communication channel is not on the reliability of communication, but on the speed of communication.” The channel capacity of an additive white Gaussian...

Ngày tải lên: 19/01/2014, 20:20

... decisions are based on local information, and each node has identical capabilities Each node can act as a publisher, a root of a multicast tree, a subscriber to a topic, a node within a multicast tree, ... Zhuang, Ben Y Zhao, Anthony D Joseph, Randy H Katz, and John Kubiatowicz Bayeux: An Architecture for Scalable and Fault-tolerant Wide-Area Data Dissemination In Proc of the Eleventh International ... schemes have some disadvantages The mechanisms that perform packet duplication consume additional bandwidth, and the mechanisms that select alternative paths require replication and transfer of group...

Ngày tải lên: 19/02/2014, 18:20

... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... molecular-chaperone activity of Artemia p26, a small heat shock /a- crystallin protein Eur J Biochem 243, 225–232 58 Liang, P., Amons, R., Clegg, J.S & MacRae, T.H (1997) Molecular characterization of a small heat...

Ngày tải lên: 22/02/2014, 04:20