0

detailed design of a plate heat exchanger

Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

Môi trường

... challenges for small scale and micro-fuel cells in terms of design, materials, effective transport of reactants, and heat management The development of physically representative models that allow ... performance and design of air-breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one-dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air-breathing ... However, these fuel cell designs have generally relied on traditional planar MEA architecture Because the majority of PEM fuel cell designs are based on planar plate and frame architecture, their...
  • 18
  • 549
  • 0
Novel design of a disk-shaped compacted micro-structured air-breathing PEM fuel cell

Novel design of a disk-shaped compacted micro-structured air-breathing PEM fuel cell

Môi trường

... distribution patterns of activation overpotentials are similar, with higher values at the catalyst layer near the air inlet area It can be seen that the activation overpotential profile correlates with ... performance and design of air-breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one-dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air-breathing ... However, these fuel cell designs have generally relied on traditional planar MEA architecture Because the majority of PEM fuel cell designs are based on planar plate and frame architecture, their...
  • 20
  • 521
  • 0
Finite time exergoeconomic performance optimization of a thermoacoustic heat engine

Finite time exergoeconomic performance optimization of a thermoacoustic heat engine

Vật lý

... / F1 and FT = F1 + F2 Here, the total heat transfer surface area FT of the two heat exchangers is assumed to be a constant (3) There is a constant rate of heat leakage ( q ) from the heat source ... transfer coefficient and F2 is the total heat transfer surface area of the cold-side heat exchanger Here the & &′ imaginary part n2 of n indicates the relaxation of a heat transfer process Defining ... i is a complex heat transfer exponent, k1 is the overall heat transfer coefficient and F1 is the total heat transfer surface area of the hot-side heat exchanger, k2 is the overall heat transfer...
  • 14
  • 411
  • 0
Tài liệu Design of a USB Device Driver ppt

Tài liệu Design of a USB Device Driver ppt

Kỹ thuật lập trình

... –First packet in any transaction –Specifies function address, endpoint –Specifies data direction ? Data - DATA0, DATA1 –0 - 1023 bytes ? Handshake - ACK, NAK, STALL –Report status of data transaction ... Driver USB Host Data Packet IN Token Data Packet Data Buffer ACK Data Packet IN Token Data Packet ACK 36 18 Control Read ? Call USBRead( EP0 ) to read a Setup Packet USBRead( –Read from EP0 OUT ... Idle Handshake ACK ACK DATA0/ DATA0/ DATA1 DATA1 NAK DATA0 T/O STALL T/O ACK Idle Host Function There are Four Types of USB Transactions ? Isochronous (Audio, telephony …) –Periodic, Bounded latencies,...
  • 28
  • 423
  • 0
Tài liệu Design of a Powerline Home Automation System pdf

Tài liệu Design of a Powerline Home Automation System pdf

Cơ khí - Chế tạo máy

... to ground, neutral to live and neutral to ground Neutral to ground has the advantage of safety, but also the disadvantage of the fact that neutral is usually grounded at the transformer, so no ... can be truly reliable One way of reducing the message transmission rate is to introduce ample redundancy into the data stream Extra bits are placed into each data word and are used to detect and ... basic limitation that noise causes in a communication channel is not on the reliability of communication, but on the speed of communication.” The channel capacity of an additive white Gaussian...
  • 55
  • 699
  • 1
Tài liệu SCRIBE: The design of a large-scale event notification infrastructure? doc

Tài liệu SCRIBE: The design of a large-scale event notification infrastructure? doc

Tổ chức sự kiện

... decisions are based on local information, and each node has identical capabilities Each node can act as a publisher, a root of a multicast tree, a subscriber to a topic, a node within a multicast tree, ... Zhuang, Ben Y Zhao, Anthony D Joseph, Randy H Katz, and John Kubiatowicz Bayeux: An Architecture for Scalable and Fault-tolerant Wide-Area Data Dissemination In Proc of the Eleventh International ... schemes have some disadvantages The mechanisms that perform packet duplication consume additional bandwidth, and the mechanisms that select alternative paths require replication and transfer of group...
  • 13
  • 631
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "DESIGN OF A KNOWLEDGE-BASED REPORT GENERATOR" doc

Báo cáo khoa học

... uncomplicated task of grouping messages into paragraphs, ordering messages within paragraphs, and assigning a priority number to each message Priorities are assigned as a function of topic and subtopic ... but it also reveals the essential semantic classes and attributes of a domain of discourse, as well as the relations between those classes and attributes Thus, samples of actual text may be used ... coordinate-sentence, subordinate-sentence, subordinate-participial-clause, prepositional-phrase, and others Semantic analysis of a sample of natural text stock reports discloses that a hierarchy of...
  • 6
  • 452
  • 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Báo cáo khoa học

... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... molecular-chaperone activity of Artemia p26, a small heat shock /a- crystallin protein Eur J Biochem 243, 225–232 58 Liang, P., Amons, R., Clegg, J.S & MacRae, T.H (1997) Molecular characterization of a small heat...
  • 10
  • 495
  • 0
Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt

Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt

Báo cáo khoa học

... Crystallization and x-ray diffraction analysis of 6-aminohexanoate-dimer hydrolase from Arthrobacter sp KI72 Acta Crystallogr F61, 928–930 Hatanaka HS, Fujiyama K, Negoro S, Urabe I & Okada H ... 489–495 Kinoshita S, Terada T, Taniguchi T, Takene Y, Masuda S, Matsunaga N & Okada H (1981) Purification and characterization of 6-aminohexanoic acid oligomer hydrolase of Flavobacterium sp KI72 ... Journal compilation ª 2009 FEBS Y Kawashima et al of a tetrahedral intermediate; (c) formation of an acyl enzyme and transition to an open form; and (d) deacylation [12] We have concluded that Asp181-COO)...
  • 10
  • 625
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "DESIGN OF A MACHINE TRANSLATION SYSTEM " pptx

Báo cáo khoa học

... accordance with these considerations Ccmputational considerations In a transfer-based MT system, actual translation takes place in transfer and can be described as the ocr~putaticnal manipulation ... influenced by target language considerations: the interface structure between analysis and transfer was defined to take advantage of the similarities between the three languages and to accommodate the ... infinitival phrases in place of deverbal nominal constructions Apart from this difference, the major textual characteristics carry over from source to target sublanguage thereby facilitating mechanical...
  • 4
  • 394
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The Design of a Computer Language for Linguistic Information" ppt

Báo cáo khoa học

... decidability of that f{,rmalism [Kaplan and Bresnan, 83] Off-line parsability req.ires that the context-free "skeleton" of the grammar allows no trivial cyclic derivations of the form A ~ A 2.3 Mathematical ... rules that are shared among lexical items, as well as by the declarative nature of the grammar formalism itself, 6The example is merely meant to be indicative of the syntax for and operation of lexical ... equi-NP properties of a verb, can be defined by means of templates, that is, DAGs that encode some linguistically isolable portion of the DAG of a lexical item These template DAGs can then be c(~mbined...
  • 5
  • 383
  • 0
Báo cáo Y học: Synthesis, conformational analysis and biological activity of cyclic analogs of the octadecaneuropeptide ODN Design of a potent endozepine antagonist pot

Báo cáo Y học: Synthesis, conformational analysis and biological activity of cyclic analogs of the octadecaneuropeptide ODN Design of a potent endozepine antagonist pot

Báo cáo khoa học

... Slobodyansky, E., Guidotti, A. , Wambebe, C., Berkovich, A & Costa, E (1989) Isolation and characterization of a rat brain triakontatetraneuropeptide, a posttranslational product of diazepam binding ... by analytical RP-HPLC revealed that the Na-Fmoc group was not totally stable in reductive media This observation was at variance with the data reported by Carpino & Han [28], who found that Fmoc-derivatives ... conclusion, we have shown that head-to-tail cyclization of the ODN agonist OP and the weak antagonist [D -Leu5]OP enhances their biological activity on rat astrocytes leading to a super-agonist and to...
  • 13
  • 632
  • 0
Optimal Design of a Hybrid Electric Car with Solar Cells pptx

Optimal Design of a Hybrid Electric Car with Solar Cells pptx

Kĩ thuật Viễn thông

... solar panels It exhibit a payback of 3.13 years The addition of and m2 of solar panels (cases 2-3) increases solar fraction up to 30% but also payback to 8.7 years, since the greater daily saving ... reliability of panels in case of lateral impacts) APV ,V ,MAX = (2l + w )(h − 0.9 ) − 0.1 w l FIG - SIMPLIFIED SCHEME OF SOLAR CAR (LATERAL AND REAR VIEW) The maximum panel area can be estimated as function ... components are shown The default values of the missing variables are reported in Nomenclature, while only their variations are indicated in the tables Although an exhaustive analysis of this large amount...
  • 12
  • 600
  • 0
Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot

Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot

Báo cáo khoa học

... recorded after addition of CYP1 1A1 to an anaerobic CO-saturated sample containing the reaction mixture FNRrd/Adxox gave rise to a peak at 450 nm together with absorbance decreases at 390, 430 and ... measuring compartment and lM CYP1 1A1 was placed in the second compartment After the samples were made anaerobic, an excess of NADPH was added to the FNR/Adx mixture to allow Adx reduction via ... providing a large amount of information about its interaction and ET properties to Fd, Fld and NADP+ [8–11] Three-dimensional structures of Anabaena wild-type (WT) FNR, several of its mutants and of...
  • 10
  • 400
  • 0
Design of a near infrared spectrophotometry brain imaging system

Design of a near infrared spectrophotometry brain imaging system

Tự động hóa

... Engineering McMaster University Hamilton, Ontario, Canada DESIGN OF A NEAR INFRARED SPECTROPHOTOMETRY BRAIN IMAGING SYSTEM BY SUKNEET BASUTA Electrical and Biomedical Engineering Faculty Advisor: Prof Doyle ... up fast neuronal signals and slow haemodynamic signals It is currently the only available imaging technique that is able to detect both signals, which is its main advantage Fast neuronal signals ... individually Continuous wave NIRS sampling can only find the combination of absorption and scattering coefficients The disadvantages to this system are basically the same as any Laser based system...
  • 88
  • 330
  • 0
Design of a constructed wetland

Design of a constructed wetland

Năng lượng

... and faecal coliform (FC) is assumed.[9] Their model is based on areal rate constants, which are independent of temperature (32) Where (33) (34) Alternatively (35) Where As is treatment area of ... hydraulic loading rate (m/yr), Q is average flow rate through the wetland (m3/day) Kadlec and Knight [9] advocate the use of the “global” parameters they determined from plug flow analysis of ... performance data available to date on the North American Data Base (NADB) [10] in other systems They suggest that specific parameters should be locally determined prior to investment in a full-scale...
  • 5
  • 449
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Design of a series visco-elastic actuator for multi-purpose rehabilitation haptic device" pptx

Hóa học - Dầu khí

... by SEA actuators) when in contact with a human We have analyzed an equivalent mechanical system where a dissipative element, a mechanical damper was placed in parallel to a spring in SEA Results: ... Access Design of a series visco-elastic actuator for multi-purpose rehabilitation haptic device Jakob Oblak*, Zlatko Matjačić Abstract Background: Variable structure parallel mechanisms, actuated ... passivity of a haptic device, based on a variable structure parallel mechanism driven by SEA actuators, when in contact with a human We have analyzed an equivalent mechanical system where a dissipative...
  • 14
  • 365
  • 0
báo cáo hóa học:

báo cáo hóa học: "Design of a complex virtual reality simulation to train finger motion for persons with hemiparesis: a proof of concept study" docx

Điện - Điện tử

... combines training of the hand and arm into an integrated task-based simulation This unique training modality is practical and accommodates and safely challenges subjects with a range of hand impairments ... unilaterally or bilaterally and combine proximal and distal training into a single activity or train each segment separately Additionally, it presents information regarding the variability among ... 10 Day Figure Daily Average Fractionation Scores During Training Daily Average Fractionation Scores During Training Upper Panel: Fractionation Average daily fractionation for Subjects S1, S2 and...
  • 10
  • 506
  • 0
báo cáo hóa học:

báo cáo hóa học: " Application of a hybrid wavelet feature selection method in the design of a self-paced brain interface system" pptx

Hóa học - Dầu khí

... potentials by means of fast wavelet transform Brain Lang 1999, 66:129-145 Samar VJ, Bopardikar A, Rao R, Swartz K: Wavelet analysis of neuroelectric waveforms: A conceptual tutorial Brain Lang 1999, ... histograms with 10 bins each, the probability function of each feature was estimated and its mutual information with each of the output classes was calculated The values of MI were calculated for all ... elimination of channels) Systematic elimination of channels can lead to a faster setup of the system as well as decreased computational time This could be part of future research works aimed at...
  • 13
  • 530
  • 0

Xem thêm