design development as a strategy to deepen understanding
Báo cáo " Self-regulated strategy development as a means to foster learner autonomy in a writing course " pdf
... goals, a 6-stage procedure for SRSD is adapted from the literature on SRSD (e.g Graham and Harris [19]; Mason, Harris and Graham [18]; Harris, Graham and Mason [20]; Chalk, Hagan-Burke and Burke ... evaluation of communicative tasks, In B (ed) Tomlinson, Materials Development in Language Teaching, CUP, 1997 L.H Mason, K.R Harris, S Graham, Every child has a story to tell: Self-regulated strategy ... more autonomous learners - Weltanschauung: The teacher strongly believes that autonomy helps learning and that learner training can contribute to promoting learner autonomy Information about learner...
- 8
- 518
- 4
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
... Q279E a- galactosidase A residual activity in patient derived cells; thus, galactose was demonstrated to be first active-site-directed pharmacologic chaperone for a lysosomal storage disease Galactose ... ameliorate Gaucher disease 19 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor Nat Med ... a- galactosidase A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as a possibility in GD Galactose administration increased...
- 7
- 507
- 0
Báo cáo y học: " Exploring mentorship as a strategy to build capacity for knowledge translation research and practice: protocol for a qualitative study" pps
... Designated Research Team Approach to building research capacity in primary care BMC Fam Pract 2008, 9(1):37 Cooke J: A framework to evaluate research capacity building in health care BMC Fam Pract ... feedback [25] Social interaction is also a powerful facilitator of learning and behaviour change Personal contact with researchers has been repeatedly cited by health professionals as the factor ... according to recommendations that are based on the best available research Numerous population-based studies in Canada, Australia, the United Kingdom and United States demonstrate low compliance...
- 8
- 592
- 0
báo cáo khoa học: " Exploring mentorship as a strategy to build capacity for knowledge translation research and practice: protocol for a qualitative study" pot
... Designated Research Team Approach to building research capacity in primary care BMC Fam Pract 2008, 9(1):37 Cooke J: A framework to evaluate research capacity building in health care BMC Fam Pract ... feedback [25] Social interaction is also a powerful facilitator of learning and behaviour change Personal contact with researchers has been repeatedly cited by health professionals as the factor ... according to recommendations that are based on the best available research Numerous population-based studies in Canada, Australia, the United Kingdom and United States demonstrate low compliance...
- 8
- 317
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... those measures that are being used in the target areas as well as foreign countries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. Some of them are introduced as follows. ... Table 7. Standardized score for costs of combinations Measure A1 +A2 .3 A1 +B1 A1 +B2 A1 +B1+B2 A2 .1 +A2 .3 A2 .1+B1 A2 .2 +A2 .3 A2 .2+B1 A2 .3+B1 A2 .3+B1+B2 Standardized cost Standardized score ... and accounts for 75% to 85% of the total yearly rainfall, whereas the dry season lasts up to 6 months, from February to July and occupies only 15‐25% of the total rainfall. ...
- 13
- 487
- 0
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps
... emphasis away from linkage analysis and microsatellite markers towards SNP genotyping and different analytical strategies based on association and haplotype analysis [31–34] Association analyses are ... increased risk of asthma J Med Genet 1998, 35:463–467 131 Mao XQ, Shirakawa T, Kawai M, Enomoto T, Sasaki S, Dake Y, Kitano H, Hagihara A, Hopkin JM, Morimoto K: Association between asthma and an ... Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa T, Deichmann KA: Genetic variants of IL-13 signalling and human asthma and...
- 11
- 491
- 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... effective measure we have to combat influenza is isolation and culling of infected fowls as demonstrated by the government of China, Vietnam, and Thailand As human populations continue to increase and ... as a protease to cleave HA which creates a systemic infection as well [1] Taubenberger [1] reported that this transformation was not observed in the1918 strain, or in strains “captured” in nature...
- 4
- 520
- 0
Development of a method to measure consumer emotions associated with foods
... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate, ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited via internet and/or phone based on ... Sensation seeking and positive affect 1.4 Facial scaling Another approach to measuring emotions has been the use of facial scaling A number of different systems for facial scaling have recently appeared...
- 10
- 781
- 3
Using eliciting question as a technique to teach english to 11th form pupils
... to help pupils understand the whole text such as a funny story Example: A tourist visiting a pub was fascinated by a stuffed lions head mounted on a mahogany plaque above a door behind the bar ... play a very important role in every classroom Teachers can create an active learning environment by encouraging students to ask and answer questions Some ideas to make student questions and teacher ... emphasizing less important material Phrase your questions carefully - Phrase your questions so that the task is clear to students Questions such as What about foreign affairs? not often lead to...
- 42
- 641
- 0
Tài liệu Using Proven Sales Techniques for Selling WorkKeys as a Solution to Business doc
... friendly manner, graciously and courteously • That you want to help them • To see you as the solution to their problem, and not be seen as your problem • To be treated as mature adults, not as children ... loves and loses and loves again a slyly dashing war profiteer as she struggles to protect her family and beloved plantation A pig raised by sheepdogs, learns to herd sheep with a little help A cynical ... because you get your work done quickly You like to sugarcoat unpleasant experiences and rationalize bad situations into good ones You have a propensity towards narcotic addiction Twisted Apart,...
- 48
- 482
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...
- 12
- 616
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... enhance PYM-induced caspase activation and subsequent PARP cleavage (F) Effect of CA9 ASO on PYM-induced caspase activation on Tca8113 ⁄ PYM cells The relative activation of caspase shown was calculated...
- 13
- 563
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
... activation of kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase ... Immediately after treatment, the cells were cooled to °C and lysed Luciferase activity was measured as described in [48] Statistical analysis All data are expressed as mean ± SD Student’s paired t-test ... stress response: characterization of changes in cytoplasmic organelles, cytoskeleton, and nucleoli, and appearance of intranuclear actin filaments in rat fibroblasts after heat-shock treatment J Cell...
- 10
- 452
- 0
A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx
... offer a clear road map as to how Bangladesh can evolve a strategy of both adaptation and mitigation of climate change Warmer and more Humid Weather - leading to increased prevalence of disease and ... serious risks and increasing pressures for coastal protection in South East Asia (Bangladesh and Vietnam), small islands in the Caribbean and the Pacific, and large coastal cities, such as Tokyo, New ... from Africa, Middle East, South Asia, East Asia and Washington to identify the global strategies for resilient business advisory and to identify the critical sectors in the space of adaptation...
- 49
- 557
- 0
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot
... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ monocyte-derived dermal dendrocytes ... Transglutaminasecatalyzed inactivation of glyceraldehydes 3-phosphate dehydrogenase and a- ketoglutarate dehydrogenase complex by polyglutamine domains of pathological length Proc Natl Acad Sci USA 94, ... the art Minerva Biotec 14, 121–128 137 Nishiura H, Shibuya Y, Matsubara S, Tanase S, Kambara T & Yamamoto T (1996) Monocyte chemotactic factor in rheumatoid arthritis synovial tissue Probably a...
- 17
- 440
- 0
the community development handbook a tool to build community capacity
... support was greatly appreciated It was presented in a way that was understood and realistic because it was based on experience with what works and what doesn't It was also validated and highly valued ... sustainable development It takes capacity to this as well as good leadership, a viable plan, motivation and the support of the community Basically, it takes capacity to build capacity, and it takes a well-thought-out ... assumption that it is familiar to us and that we have a part to play in it This handbook has been created by the Labor Market Learning and Development Unit at Human Resources Development Canada...
- 90
- 284
- 0
báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot
... FA, Ventura JL, Casas M, Casas H, Pages T, Rama R, Ricart A, Palacios L, Viscor G: Erythropoietin acute reaction and haematological adaptations to short, intermittent hypobaric hypoxia Eur J Appl ... installation of the hypobaric chamber and annexed facilities We are also grateful to Mr Juan A Silva from Universidad de Antofagasta (Chile) by his collaboration in some data collection, and to ... and/or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript writing All authors read and approved the final manuscript Additional...
- 6
- 426
- 0
báo cáo sinh học:" A strategy to improve skills in pharmaceutical supply management in East Africa: the regional technical " potx
... Kenya, Tanzania and Rwanda National HIV/AIDS pharmaceutical supply management training programmes Uganda, Kenya, Tanzania, Rwanda USAID/RPM Plus Program HIV/AIDS pharmaceutical supply management ... including Ghana, Liberia and Namibia, have since adapted these materials for local use Training on HIV/AIDS pharmaceutical management In Uganda and Tanzania the RTRC has been actively participating ... training consultancies Evaluating MTP as a skills-building approach for HIV/AIDS pharmaceutical management Conducting locally-based Drugs and Therapeutics Committee Course in Uganda and Tanzania...
- 6
- 366
- 0
Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx
... Sugita N, Yoshizawa M, Abe K, Tanaka A, Watanabe T, Chiba S, Yambe T, Nitta S: Evaluation of adaptation to visually induced motion sickness based on the maximum cross-correlation between pulse transmission ... SCL, BVP, RR and Temp, the slope from baseline to termination was calculated for each subject, i.e., (Last measurement – baseline)/ST For eye movement data, the slope was instead calculated from ... perceived state The NoFix slope increased as Mal slope increased, a finding that was expected [16,17] As mentioned, fixation time and NoFix are related measurements Actually, fixation time is...
- 9
- 609
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008