densities of gases at standard conditions 0c 1 atm
Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx
... Journal compilation ª 2008 FEBS 2735 Molecular basis of perinatal form of hypophosphatasia 10 11 12 13 14 15 16 17 18 19 N Numa et al establishment of a model of infantile hypophosphatasia Dev Dyn ... association with a marked reduction in the Kcat value, resulting in a Kcat ⁄ Km value that was < 10 % of that of the wildtype enzyme (Table 1) , indicating that the conversion of valine to alanine at ... basis of perinatal form of hypophosphatasia N Numa et al Hypophosphatasia is caused by various mutations of the tissue-nonspecific alkaline phosphatase (TNSALP) gene (EC 3 .1. 3 .1) [1 6] To date a...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... 44/ 716 44/587 59/750 90/750 12 2/750 15 0/750 274/750 274/587 1. 5 ND 6.7
Ngày tải lên: 07/03/2014, 15:20
Activities to increase a dult learners' retention of vocabulary at Yenbai Centre of Continuing Education Các hoạt động nhằm nâng cao khả năng lưu nhớ từ vựng c
... 1. 1 .1 Definition of vocabulary 1. 1.2 Vocabulary: What needs to be taught? 1. 1.2 .1 Form: Pronunciation and Spelling v 1. 1.2.2 Aspects of meaning 1. 1.2.3 ... 13 1. 3 .1 Noticing 14 1. 3.2 Retrieval 14 1. 3.3 Generation 15 1. 4 Repetition and vocabulary retention 15 1. 4 .1 Types of repetition 15 ... 1. 1.2.4 Word formation 1. 1.2.5 Collocation 1. 1.3 The roles of vocabulary in Foreign Language Acquisition 1. 2 Factors affecting the retention of vocabulary 1. 2.1...
Ngày tải lên: 28/03/2015, 09:02
Designing an ESP reading syllabus for first-year students of Architecture at Hanoi University of Business and Technology = Thiết kế chương trình đọc hiểu t
... interpreted as lacks, that is, what the students not know or cannot in English (Robinson, 19 91, p.8) 1. 4.2 Types of needs 1. 4.2 .1 Target needs 15 Hutchinson and Waters (19 87) point out that target needs ... INTRODUCTION Rationale of the study Globalization has made English an international language of communication that is used by an increasing number of people from a wide range of occupational contexts ... 17 2 .1 Research methods 17 2.2 Data collection instruments 17 iv 2.3 Data collection procedure 21 2.4 Method of data analysis 22 CHAPTER III DATA...
Ngày tải lên: 28/03/2015, 10:06
Effects of English collocation instruction on the writing skill of first year English major students at Hanoi University of Science and Technology = Ảnh hưởng c
... Doing collocation exercises: Talking about ECIU - pp 11 0 -11 1 cause and effect Week 12 Week 13 Doing collocation exercises: Agreeing and Argumentative essays Week 14 Week 15 ECIU - pp 11 4 -11 5 disagreeing ... LITERATURE REVIEW 2 .1 Overview of collocation 2 .1. 1 Definition of collocations 2 .1. 2 Characteristics of collocations 2 .1. 3 Types of collocations 10 2.2 ... characteristics of collocations is that collocations are pre-fabricated phrases (Howarth, 19 98a, p 25; Hill, 2000, p 47; Pawley & Syder, 19 93 as cited in Seretan, 2 011 , p & p 16 ) Seretan (2 011 ) claims that...
Ngày tải lên: 28/03/2015, 10:15
Electronic and magnetic properties of two dimensional electron gases at complex oxide interfaces for different polar systems and crystallographic orientations
... 13 2 .1 ABO3 perovskite oxides 13 2 .1. 1 SrTiO3 15 2 .1. 2 LaAlO3 16 2 .1. 3 BaTiO3 17 2 .1. 4 Site termination control of ABO3 oxides 20 2.2 2DEG at ... spacing of (10 0) STO of 0.39 nm (c) AFM topography image of the STO (11 0) surface after treatment.(d) AFM height profile showing the step height is equal to a unit cell spacing of (11 0) STO of 0.278 ... samples grown at 1 10 -5 Torr Figure 4 .14 : AMR measured with varying temperature at T for the LAO/STO interface grown on NGO (11 0) substrate Figure 5 .1: Schematic representation of the polar/non-polar...
Ngày tải lên: 10/09/2015, 09:11
Gang of Four Design Patterns 2.0
... Design Pattern Framework™ 2.0 Index 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Index Introduction The Gang of Four patterns Abstract ... different steps of creating the separate procedures that create the CRUD statements (Create, Read, Update, Delete) are all very similar Builder is a creational pattern just like the Factory patterns ... classes that are implementations of the Factory design pattern Copyright © 2006, Data & Object Factory All rights reserved Page 10 of 87 Design Pattern Framework™ 2.0 Builder Definition Separate the...
Ngày tải lên: 12/09/2012, 14:38
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"
... treatment Group n Normal group High fat diet group Losartan group Plasma cholesterol (mmol/L) Baseline weeks 1. 35±0 .18 1. 37±0 .12 Body weight (kg) Baseline 2.87±0. 21 weeks 3. 01 0.24 1. 34±0 .10 1. 68±0 .13 ** ... 3. 01 0.24 1. 34±0 .10 1. 68±0 .13 ** 2. 81 0.20 3 .16 ±0.20 1. 36±0 .18 1. 61 0 .15 ** 2.82±0.20 3.07±0 .16 Data were expressed as mean±SD P＜0. 01 vs Normal group; Losartan group vs high fat diet group P ** ＞0.05 ... relative optical density of the Cx43 and Cx40 of different groups Normal group High fat diet group Losartan group Cx43 (n=7) 0.63±0 .10 Cx40 (n=7) 0. 71 0 .13 1. 39±0.08** 1. 17±0 .12 ** 0.96±0.09*## 1. 07±0 .14 ...
Ngày tải lên: 26/10/2012, 09:39
International payment service by opening Letter of Credit at Vietnam Eximbank Hanoi Branch.doc
... Bill(USD) Ex-Import Bill 2006 319 51, 643.50 14 4, 17 6.07 35.5% 2007 3 91 58, 419 .12 18 0, 13 8 .19 32.4% 2008 384 61, 135.34 19 6, 17 1.05 31. 6% (Source: Annual report of Vietnam Eximbank Hanoi Branch) ... 837.64 92, 533.57 10 4, 18 5.7 12 1, 719 .07 11 2, 915 .4 13 5,035.66 (Source: Annual report of Vietnam Eximbank Hanoi Branch) Import L/C In 2006, Hanoi Branch of Eximbank opened 8 71 items of Import L/C ... A2/K44/BBE balance of 12 , 910 billion VND; increasing by 12 1% profits before tax of 12 9 billion VND, reaching 10 4% The amount of international settlement will be about 35-40% higher than that of last year...
Ngày tải lên: 27/10/2012, 16:44
Teaching speaking skill for non-major ma students of english at vnuh
... unit being taught Unit Suggested 1, 3,4, activities 5, 1, 3,4, 5,6,7, 8, 14 1, 3, 4, 1, 3, 4,5, 13 1, 3, 4,5, 12 1, 3, 4,5,7, 11 ,13 1, 2, 3,4,5, 9 10 1, 3, 1, 3, 4, 5, 4, 10 1, 3, 4, Table 8: Activities suitable ... dessert is and what is it made of Roll of 11 a Tell us what state in the United States has the most people b Tell us the names of five different pieces of furniture c Tell us the name of the largest ... the repeated oral production of structures concentrating on the development of grammatical and phonological accuracy combined with fluency” (Bygate, 20 01, p 15 ) The theoretical basis of the...
Ngày tải lên: 07/11/2012, 14:26
How group work is used in speaking lesson of the first year major students of english at viet nam university of commerce
... lesson are mentioned at the end of the chapter 2 .1 Communicative Language Teaching (CLT) 2 .1. 1 Some concepts of CLT The arrival of Communicative Language Teaching was in the late 19 60s and its origins ... group of learners through an analysis of genuine, realistic situations - The use of authentic, from-life materials - The use of group activities - The attempt to create a secure, non-threatening atmosphere ... 1st year students at University of Commerce? 19 What strategies teachers use to stimulate and foster English language use by the 1st year students at University of Commerce in group work? What...
Ngày tải lên: 07/11/2012, 14:50
An investigation into the reality of teaching and learning speaking skills to the 2nd year non-major english students at pre-intermediate level of proficiency at hanoi university of industry
... Methods of the study VI Design of the study PART TWO: DEVELOPMENT Chapter one Literature review 1. 1 Communicative Language Teaching (CLT) 1. 1 .1 Concept of CLT 1. 1.2 Characteristics of CLT 1. 1.3 Conditions ... of Speaking Skill 1. 3 Problems with Speaking and Speaking activities 10 1. 3 .1 Problems with Speaking 1. 3.2 Problems with Speaking Activities 10 11 1. 4 Motivation 12 1. 4 .1 Definition of Motivation ... Objectives at HaUI 15 2 .1. 2 Description of the Students at HaUI 16 2 .1. 3 Description of the Teachers at HaUI 17 2.2 The Study 17 2.2 .1 Participants 17 2.2.2 The Setting of the Study 18 2.2.3 The Data...
Ngày tải lên: 07/11/2012, 14:50
Coding Standard 4.0
... STT I Thời Gian 21/ 03/2 011 22/04/2 011 13 /05/2 011 17 /05/2 011 Version 1. 0 2.0 3.0 4.0 Nội Dung Hoàn thiện dần nội dung chuẩn mã nguồn Hoàn thiện ... MyCompany = "12 34567894800000940000000602000000240000"+ "5253 413 100040000 010 0 010 007D1FA57C4AED9F0"+ "A32E84AA0FAEFD0DE9E8FD6AEC8F87FB03766C83"+ "4C99921EB23BE79AD9D5DCC1DD9AD23 613 210 290"+ "0B723CF980957FC4E17 710 8FC607774F29E8320E"+ ... "4C99921EB23BE79AD9D5DCC1DD9AD23 613 210 290"+ "0B723CF980957FC4E17 710 8FC607774F29E8320E"+ "92EA05ECE4E821C0A5EFE8F1645C4C0C93C1AB99"+ "285D622CAA652C1DFAD63D745D6F2DE5F17E5EAF"+ "0FC4963D261C8A12436 518 206DC093344D5AD293"; } [StrongNameIdentityPermission(SecurityAction.LinkDemand,...
Ngày tải lên: 20/03/2013, 07:30
Some difficulties in reading lessons of students at Sao Viet centre and some suggested solutions
... .8 1. 2 .1. 1 Students’ motivation .8 1. 2 .1. 2 Purpose of reading 1. 2 .1. 3 Strategies of reading 10 1. 2 .1. 4 Skills of reading 11 1. 2.2 Objective ... communicative functions 1. 2 Factors that affect learners’ reading result 1. 2 .1 Subjective factors 1. 2 .1. 1 Students’ motivation Students’ motivation is a very important part to ensure the success of ... Teaching Implications 3 .1 Suggestions for students 21 3 .1. 1 Previewing . 21 3 .1. 2 Predicting 21 3 .1. 3 Guessing from the context .22 3 .1. 4 Skimming...
Ngày tải lên: 10/04/2013, 10:36
MAKING A CHART OF THE ENERGY CONSUMPTION IN H.C.M. CITY
... PLAN MAKING A CHART OF THE ENERGY CONSUMPTION IN H.C.M CITY INTRODUCTION OF GOAL • In new basic program of English 11 .Unit 11 “sources of energy” Part D writing: describing information from the chart ... are led Completing the group’s duty Having the creative combination’s ideas +1 Having plenty of properly illustrated pictures +1 Beautiful shape +1 CONCLUSION • Realistic knowledge is impossible ... neighbour to take the notes of the amount of energy they spent (water, electricity, ,oil,coal…) in a module of time or looking for from many different areas (survey, geothermatics, environment, factories)...
Ngày tải lên: 22/07/2013, 01:27
Implications of building energy standard for sustainable energy efficient design in buildings
... proceedings of WEC COP 11 December 2005 [13 ] Janda : World Status of Energy Standard for Buildings http://www.eci.ox.ac.uk/publications/downloads/janda09worldwidestatus /cited 2009 [14 ] World Bank: ... training of property managers, builders and engineers, lack of specialized professionals to ensure implementation Based on the above information, the level of implementation of building energy standards ... other appliances application [ 21] A feature of the residential standards is intended to allow natural ventilation to reduce overheating However, in 2005 enforcement legislation was said to still...
Ngày tải lên: 05/09/2013, 14:58