denote the start of a code block in razor views
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... clashes with the aromatic ring of Tyr269, and these unfavorable interactions could lead to a decrease of local flexibility and an increased Ea value The validity of the above interpretation was ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A/ Y26 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation...
- 6
- 488
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial ... [13] Quantification of the data indicated that the cross-linking efficiency of the mutant nascent chains was somewhat reduced (Fig 3B) In conclusion, our results show an increased affinity of the G-10C ... molecules may still rely on the SecB pathway, because of overloading of the SRP pathway The re-routing of (G-10L)prePhoE to the Sec translocon via the SRP instead of the SecB pathway could be explained...
- 8
- 546
- 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after ABA treatment All the spectra ... of the HR in the PR zone was significantly suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage increased dramatically within 12–24 h, whereas in the PR zone the ... with the following oligonucleotide primers: 5¢-TGAATTCAATAATGTCTAACTTCCGCGCTCTGTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT GATGATGCAGTGACGCGCACGTAGA-3¢ For the successful protein expression, a yeast...
- 15
- 479
- 0
Báo cáo lâm nghiệp: "Spatio-temporal pattern of bog pine (Pinus uncinata var. rotundata) at the interface with the Norway spruce (Picea abies) belt on the edge of a raised bog in the Jura Mountains, Switzerland" doc
... class reduction (AGC single value) Abrupt growth change mean curve (AGCm curve) was based on annual values and was the mean of all AGC single values of all bog pines of the transect, using the ... (LV3) The basal area of Norway spruce increased from the wettest subplot towards the drier ones at the edge of the bog For the living bog pines, the maximum basal area was found in the middle of the ... used as descriptors for calculating the Euclidean distance matrix comparing all the individual trees Prior to the analysis, the data were standardised (zero mean and unit variance) Based on the...
- 10
- 277
- 0
Báo cáo y học: "Ultrasound in the diagnosis of a median neuropathy in the forearm: case report" doc
... anatomic abnormalities [3,5] This case demonstrates that it may be valuable in establishing an anatomic etiology and directing appropriate management in a diagnostically challenging case of median ... subsequent healing It has been shown that HRUS may be used as an adjunct to physical examination and electrodiagnostic findings in the diagnosis of nerve entrapment neuropathies in the absence of anatomic ... symptomatic arm in clear contrast to the Approximately one year had passed since the initial injury and based on the progressive weakness, new sensory findings, and ultrasonographic changes, median nerve...
- 4
- 372
- 0
Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps
... demonstrated that oral inoculation of live attenuated Lmdd and i.v D-ala administration was safe and well tolerated in rhesus macaques Liver toxicity secondary to bacterial invasion can be a serious ... monkeys, indicating limited bacterial invasion into the liver, or complete clearance, by days after boost vaccination Our pilot results warrant the testing of attenuated Lm vectors as part of an orally ... shown in parentheses for each group All Lmdd-gag vaccinations were preceded by oral administration of saturated sodium bicarbonate D-ala (640 mg/kg) was co-administered intravenously before and after...
- 7
- 393
- 0
Báo cáo y học: "Theoretical analysis of the mechanisms of a gender differentiation in the propensity for orthostatic intolerance after spaceflight" docx
... only a variance in their longitudinal center of gravity Computer Systems Analysis of the Hypothesis The hypothesis was examined through a systems analysis approach using a derivative of a well-established ... have a lower COG [10] The graphs in the results are intended to reflect the propensity of females to have OI as a result of their population average of a lower COG A finding of a lower COG and a ... Coleman TG, Meck JV: Development of the Digital Astronaut Program for the Analysis of the Mechanisms of Physiologic Adaptation to Microgravity: Validation of the Cardiovascular System Module Acta...
- 8
- 337
- 0
Báo cáo y học: "A day in the life of a genome biologist in the not-too-distant future" pdf
... overthrow of capitolism (HAVOC) Act of 2011 made it illegal for journals to reject papers or to make a profit, all journals now accept all papers automatically so paper was immediately accepted by all ... scientists have had the right to submit their papers simultaneously to as many journals as they like, and to have the same paper published in up to five journals at once.) Since the Harold Varmus overthrow ... trans-fat sandwich on tobacco leaf bread Paused to reflect how amazing that earlier generations of scientists actually considered this unhealthy - exactly the opposite of what careful research has...
- 2
- 437
- 0
INVESTIGATING THE COMPATIBILITY OF a PROTOTYPE SCAFFOLD IN a NOVEL NEAR CELLSHEET APPROACH
... 1998) SAPs are also amenable to further modification via a level as small as one amino acid Biologically active domains can therefore be left flagging via a glycine spacer on the C-termini of one ... California, USA) Upon saturating the atmosphere with argon gas (Soxal, Singapore), plasma was generated at 30 W and maintained for a desired period A thin layer of 1.5 mg / mL neutral bovine collagen ... proteases Insulin-like growth factor-1 tethered to the peptide scaffold via a biotin / streptavidin sandwich approach remained capable of inducing in vivo Akt phosphorylation and cardiomyocytes maturation...
- 135
- 294
- 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache refresh ... when the data manager relinquishes that memory If the data manager does not process and release the data within an adequate period of time, the data may then be paged out to the default pager In ... when it initiates a cache replacement A data manager may restrict the use of cached data by issuing a pager_data_lock request, specifying the types of access (any combination of read, write, and...
- 23
- 1,290
- 1
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... 2003 The study included the data obtained from all of the four university hospitals, and one referral tertiary-care educational state hospital in Ankara These hospitals have a total of 6668 beds ... calculated by two-tailed Spearmans coefficient (r) for non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis ... on the antibiotic use, financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases,...
- 6
- 692
- 0
596 THE USE OF RELATIONSHIP MARKETING TECHNIQUES IN HIGHER EDUCATION A CASE STUDY
... Dalat 2.2.2 Chức năng, hiệu suất Marketing du lịch Dalat: Stephan Haeckel, giám đốc Viện Kinh doanh IBM, quan niệm “tương lai Marketing “một” chức doanh nghiệp, mà “cái” chức doanh nghiệp” Marketing ... Nam gần n a kỷ qua, vùng rau hoa lớn nước khu vực Dalat sản xuất 100.000 rau loại cung cấp cho thị trường Hồ Chí Minh, tỉnh ph a Nam, miền Trung xuất sang Nhật Bản, Đài Loan, Hồng Công, Singapore ... Các sở, ngành có liên quan tỉnh doanh nghiệp tập trung đầu tư nâng cấp khu nghỉ dưỡng đ a bàn, bật khu resort Hoàng Anh - Dalat, khu nghỉ mát resort Anna Mandara Villas Dalat, khu biệt thự Trần...
- 162
- 1,128
- 2
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company
... wise to adopt the internal law as governing law to the contract On the other hand, the parties can agree to adopt a certain world law regarding international trade that can listed here as CISG ... line with the registration - Registering, enumerating and paying taxation as well as performing other financial obligations in accordance with the prevailing laws - Ensuring product quality in ... as well as the domains of real estate and logistics The group is also one of the largest manufacturing and exportation bases of electric appliances in China Major products by Midea Group include...
- 41
- 614
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25