dementia a new risk factor wasn t it hypertension
báo cáo hóa học: " Secretory PLA2-IIA: a new inflammatory factor for Alzheimer''''s disease" pot
Ngày tải lên :
19/06/2014, 22:20
... astrocyte cultures In this study, primers for sPLA2IIA are: forward 5'- GACTCATGACTGTTGTTACAACC-3' and reverse 5'-TCTCAGGACTCTCTTAGGTACTA-3' that amplify a 493 bp fragment, and primers for β-actin are: ... Because IL-1β secreted by activated microglia is involved in initiating astrocyte activation and inflammatory cascade [49], its ability to induce sPLA2-IIA mRNA in astrocytes suggests that sPLA2-IIA ... forward 5'-TGGAGAAGAGCTATGAGCTGCCTG-3' and reverse 5'-GTGCCACCAGACAGCACTGTGTTG-3' that amplify a 289 bp fragment [39] After amplifications of 40 cycles for sPLA2-IIA or 25 cycles for β-actin, a...
- 11
- 389
- 0
báo cáo khoa học: "A new predisposing factor for trigemino-cardiac reflex during subdural empyema drainage: a case report" pot
Ngày tải lên :
11/08/2014, 02:22
... adds a new and important risk factor for the intraoperative occurrence of TCR to the existing literature It seems that infected intracranial tissue may be a new predisposing factor in combination ... (normal value, 0.1 to 0.8) The patient was diagnosed with a subdural empyema and an indication for the operative treatment was set Anesthetic technique The patient underwent surgery several days after ... Lausanne, Switzerland 4Department of Neurology, University Addis Ababa, Ethiopia Authors’ contributions TS and BS wrote the article TS collected the data BS interpreted and analyzed the data SK and CK...
- 4
- 198
- 0
Báo cáo y học: " Is Ankyrin a genetic risk factor for psychiatric phenotypes?" pot
Ngày tải lên :
11/08/2014, 15:22
... participated in the coordination BP and GS carried out the diagnostic evaluation of the patients; MG carried out the statistical analyses, coordinated the study and wrote the manuscript All authors ... Chemistry (IFCC) and by grant FI2009-00229 from the Generalitat de Catalunya We thank Nalisoa Randriamahefa for her excellent technical assistance We also thank DFG for support Author details Faculty ... All genotype experiments were made at least in duplicate, with quality control of automated allele calling by two independent operators blind to phenotype The calling rate was 99% Software FAMHAP...
- 5
- 422
- 0
A new risk equation safeguarding the business model
Ngày tải lên :
06/12/2015, 23:04
... looks at credit swap data and other indicators that monitor the macroeconomic picture The data has also increased its knowledge of customers and ability to service their needs At the same time, the ... in tears simply weren t heard.” The evidence so far is that the current heightened risk management activity is part of the traditional cycle rather than a fundamental re-think For one thing, the ... in-depth interviews with practitioners, suggests that the complacency extends to corporate approaches to risk management As the pain caused by the recession eases, there is a danger that so too...
- 28
- 208
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
Ngày tải lên :
17/04/2013, 16:09
... dãy âm t có liên hệ với nhau, t o thành t với m t bên nó, -46- t c vỏ âm thanh, vỏ ngữ âm t , t ngữ âm; thứ hai, v t gọi t đó; thứ ba, ý ngh a mà t gây ý thức T t ba yếu t gắn với nhau…” ... dạng thường có hai âm ti t, âm ti t thứ mang huyền (2) không (1), phần vần phụ âm đầu âm ti t r t gọn giữ nguyên, điệu -41- thay đổi thay vào hỏi (?); âm ti t thứ hai lược bỏ Nếu âm ti t thứ ta ... ) ta t m t t sau: X(0hoặc \ ) + " ẤY " = X? [109; 3] Hoặc r t gọn kiểu hổm (t hôm đến hôm nay), thû (t thû ấy/ đến nay), thû (t thû ấy/ đến giờ) V a r t gọn v a đảo tr t tự câu nghi vấn t nh...
- 137
- 853
- 0
Tài liệu A New Angle on Sovereign Credit Risk - E-RISC: Environmental Risk Integration in Sovereign Credit Analysis ppt
Ngày tải lên :
16/02/2014, 03:20
... have added a valuable new layer of information to traditional analysis However, it means that ESG ratings tend not to be explicitly linked to the economic, fiscal and political factors that make ... 38 SustainAbility(2011) Rate the Raters Phase Two: Taking Inventory of the Ratings Universe SustainAbility Available at: http://www.sustainability.com/library/rate-the-raters-phase-two#.UA0OnrSo9X8 ... sustainability practice at all levels of financial institution operations Global Footprint Network Global Footprint Network is an international think tank working to advance sustainability through...
- 40
- 397
- 0
Tài liệu The Tunguska Event Maybe It Wasn’t What We Thought ppt
Ngày tải lên :
19/02/2014, 18:20
... Tunguska event is that there is no trace of either asteroidal or cometary material at the site of the explosion Usually, authors of Tunguska hypotheses pay careful attention to this fact and try to ... the factor which had stimulated thermoluminescence at Tunguska somewhat too cautiously ‘unknown,’ but now it s time to tell that we cannot see any rational alternatives to identifying this with ... subjected It s at this point that “ESP” makes its only appearance in the statue to fourteen months of grueling tests to determine the book, and it is handled derogatorily Gary Klein, an exits authenticity,...
- 20
- 493
- 0
Team Risk Management: A New Model for Customer- Supplier Relationships doc
Ngày tải lên :
23/03/2014, 23:21
... management compared to a typical activity in Team Risk Management Function Initiate In Risk Management There is no comparable activity (the first activity is to identify risks) In Team Risk Management ... commit to create the team culture Either customer or supplier may initiate team activity, but both must commit to sustain the teams CUST OMER INITIA TE TEAM IDENTIFY ANAL YZE SUPPLIE R CONTROL ... evaluation, and adjustment What Risk Management Adds to Project Management Risk management looks ahead in the project and adds a structured approach for the identification and analysis of risks to...
- 30
- 521
- 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
Ngày tải lên :
29/03/2014, 21:20
... CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG ... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG ... primer mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R TGGCACTGATTTTGGCTCCT mp65NFjB.F...
- 16
- 462
- 0
catastrophe modeling a new approach to managing risk
Ngày tải lên :
01/06/2014, 01:26
... enough to attract capital from investors In addition, the prospect of an investment uncorrelated with the stock market or general economic conditions is attractive to capital market investors Finally, ... 250 communities participated in Project Impact Federal legislation that promotes natural disaster mitigation is another way to manage catastrophe risk The Earthquake Loss Reduction Act of 2001 ... minimum amount of capital required below which the state has the authority to take action against the company Rate or market regulation attempts to ensure fair and reasonable 12 insurance prices,...
- 266
- 317
- 0
IT and the environment A new item on the CIO’s agenda? potx
Ngày tải lên :
29/06/2014, 04:20
... of respondents) Critical factor Important factor Moderately important factor Minor factor Not a factor Not applicable/Don t know Reliability 63 29 11 Price 32 57 11 After-sales support 30 51 15 ... that consumers will shift over the next two or three years, but it s not really that strong at the moment.” 70 IT and the environment A new item on the CIO’s agenda? The action being taken Not ... 9% that aim to be carbon neutral For the majority of firms, there is little action that appears particularly ambitious While there is a high level of awareness of climate change issues, when it...
- 22
- 307
- 0
Báo cáo lâm nghiệp: "Frost damage on the terminal shoot as a risk factor of fork incidence on common beech (Fagus sylvatica L.)" docx
Ngày tải lên :
07/08/2014, 16:20
... plots P1 and P2 together, confirmed that “damage” was an explanatory factor which was much significant than the other variables and factors available Thus overall, the damage factor had both a statistical ... characteristics are always difficult to define accurately at the tree scale This type of experiment also has the advantage that the relative risks can be calculated easily It should be noted that this ... 0.36 (Tab Ia) This meant that at the scale of all the plants in plot P1, the additional fraction of plants with forks which could be attributed to damage following the late frost of 15 May 1995,...
- 8
- 348
- 0
Báo cáo y học: "Advanced paternal age is a risk factor for schizophrenia in Iranians" pps
Ngày tải lên :
09/08/2014, 01:21
... clinical sample data and drafted the manuscript BM participated in sample collection MN performed data analysis and CLS contributed to the editing and writing of the manuscript All authors read and ... [37,38] These observations suggest that genetic susceptibility is transmitted to offspring, but environmental factors also contribute in disease occurrence and presentation An elevated somatic mutation ... approaches Table Sample classes as a function of parental or maternal age at birth Group Parental age at birth, n (%) Paternal Total (P = 0.065) Maternal 32 years
- 6
- 405
- 0
Báo cáo y học: "Rheumatoid arthritis is an independent risk factor for multi-vessel coronary artery disease: a case control study" pdf
Ngày tải lên :
09/08/2014, 06:23
... mortality in RA but the results are inconsistent [23,25] DMARD treatment can actually improve the outcome in RA Choi and colleagues [36] have demonstrated that methotrexate-treated patients had ... results show that patients with RA have more advanced coronary atherosclerosis at the time of CAD diagnosis compared with patients without RA (Table 2) This occurs independently of the traditional ... characteristics of the patients with RA Average age at onset of RA was 55 years and the average disease R986 Arthritis Research & Therapy Vol No Warrington et al Table Patient demographics RA +...
- 8
- 401
- 0
Báo cáo khoa học: "Upper abdominal body shape is the risk factor for postoperative pancreatic fistula after splenectomy for advanced gastric cancer: A retrospective study" ppsx
Ngày tải lên :
09/08/2014, 07:21
... have shown that pancreatic complications are a major cause of mortality after gastrectomy [8,9] Moreover, postoperative pancreatic complications are difficult to treat and prolong hospitalization ... Pancreas-preserving total gastrectomy with splenectomy was reported to be superior to total gastrectomy with pancreaticosplenectomy with respect to mortality, morbidity, and 5-year survival rate ... First, a major limitation of our study was the low-power statistics because of the small number of patients enrolled to this study At our institution, although most patients with advanced gastric...
- 7
- 385
- 0
Báo cáo y học: " Is distortion of the bioprosthesis ring a risk factor for early calcificatio" docx
Ngày tải lên :
10/08/2014, 09:22
... Spain 2Department of Radiology, Santiago de Compostela University Hospital La Choupana, Santiago de Compostela 15706, Spain 3Department of Pathology, Santiago de Compostela University Hospital ... speculate that Dacron ring traction from the annular stitch may distort the normal planar geometry of Mitroflow pericardial bioprosthesis, leading to distortion of the pericardial leaflet mounted ... calcification? Journal of Cardiothoracic Surgery 2010 5:77 Author details Department of Cardiovascular Surgery, Santiago de Compostela University Hospital La Choupana, Santiago de Compostela 15706,...
- 3
- 370
- 0
báo cáo khoa học: " Intestinal adhesion due to previous uterine surgery as a risk factor for delayed diagnosis of uterine rupture: a case report" pot
Ngày tải lên :
10/08/2014, 23:20
... hours postpartum; postural hypotension was the sign that attracted the physicians’ attention, leading to the diagnosis The present case did not show postural hypotension Our patient remained lying ... or at least acute abdomen requiring laparotomy CTG subsequently indicated recurrent late deceleration, requiring an emergent Cesarean section Laparotomy revealed that her small intestine tightly ... inducing a tight intestinal adhesion at the site, may mask the symptoms and signs of a rupture We cannot exclude the possibility that intestinal adhesion might have been a coincidental phenomenon...
- 3
- 328
- 0
Báo cáo y học: "An exploration of how clinician attitudes and beliefs influence the implementation of lifestyle risk factor management in primary healthcare: a grounded theory study" pot
Ngày tải lên :
11/08/2014, 05:21
... as an important moderator to developing approaches that fitted with the mechanics of everyday practice At the macro-level, the extent to which risk factor management was seen to fit with the ... expectations and intentions appeared to act as a cognitive framework or mindset shaping clinicians' intervention practices Risk factor management practices Clinicians' risk factor management practices ... implementing these practices The model constructs are largely in line with previous quantitative and qualitative studies suggesting that a combination of patient, contextual, and provider factors shape...
- 15
- 708
- 0
báo cáo khoa học: "An overview of cardiovascular risk factor burden in sub-Saharan African countries: a socio-cultural perspective" ppsx
Ngày tải lên :
11/08/2014, 14:21
... poverty, and urbanization [62,63], without any attention to the socio-cultural context of food intake Similar to other cultural activities in the African context, food intake is a cultural activity that ... literature search and drafted the manuscript JI conducted the literature search and drafted the manuscript KDT conducted the literature search and contributed to drafting and editing the manuscript AD ... implementing strategies to track non-attenders in cases where http://www.globalizationandhealth.com/content/5/1/10 healthcare is centralized to a far away location Gil et al (2008) [37] attributed lack...
- 12
- 516
- 0