declaring and initializing c variables

Báo cáo y học: "Identification of clinical and simple laboratory variables predicting responsible gastrointestinal lesions in patients with iron deficiency anemia"

Báo cáo y học: "Identification of clinical and simple laboratory variables predicting responsible gastrointestinal lesions in patients with iron deficiency anemia"

... Colonic polyp Diverticulitis Coeliac disease Gastric ulcer Duodenal ulcer Chronic colitis IID2 Atrophic gastritis Interstitial colitis Gastric polyp Erosive gastritis Gastric cancer Colonic cancer ... evaluation can be endoscopic and radiographic Asymptomatic colonic and gastric carcinoma may present with IDA and exclusion of these conditions is of prime concern The upper endoscopic evaluation ... Peptic ulcer IID*/chronic colitis Diverticulitis Gastric cancer Colon cancer Familial polyposis Helicobacter pylori gastritis 1 18 Inflammatory intestinal disease (Not: Hemorrhoid did not considerate...

Ngày tải lên: 25/10/2012, 11:18

9 425 1
Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

... seroclearance Int J Med Sci 2006, 60 Dual Infection of HBV and HCV and hepatocellular carcinoma (HCC) Conflict of interest HBV and HCV infections are confirmed causes of HCC What’s the combined ... that occult infection may contribute to chronic liver damage and the development of HCC [32, 33, 34, 35] Cacciola [36] studied the prevalence and clinical significance of occult HBV infection ... effect of HBV and HCV coinfection on HCC? Accumulated epidemiological data suggested that coinfection with HBV and HCV could increase the risk for development of HCC A case-control study [51] conducted...

Ngày tải lên: 02/11/2012, 09:51

6 621 1
Customer Service - Principles of Service Marketing and Management - C Lovelock & L Wright

Customer Service - Principles of Service Marketing and Management - C Lovelock & L Wright

... exclusively— those w h o are in direct contact with customers promotion and education: all communication activities and incentives designed to build customer preference for a specific service ... service delivery system, balancing demand and capacity, applying technology to service processes, and managing people as part of the service product Balancing Productivity and Quality Concerns ... posterity; and transformed into a manufactured product, such as a compact disc, videotape, or audiocassette, which may then be packaged and marketed CHAPTER TWO • UNDERSTANDING SERVICE PROCESSES much...

Ngày tải lên: 07/02/2013, 09:52

387 1,2K 6
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

... N., Mayne, G .C. , Olejnicka, B., Negre-Salvayre, A., Stı´ cha, M., Coffey, R.J & Weber, C (2001) Induction of cancer cell apoptosis by a-tocopheryl succinate: molecular pathways and structural requirements ... kB-dependent mechanism J Immunol 161, 6206– 6214 31 Chen, C. -C. , Chiu, K.-T., Sun, Y.-T & Chen, W. -C (1999) Role of the cyclic AMP-protein kinase a pathway in lipopolysaccharideinduced nitric oxide ... LPS/IFN Effects of protein kinase inhibitors on the enhancement by TS of LPS/IFN-induced NO production Protein kinases such as PKA and PKC, and various factors such as tumor necrosis factor receptor...

Ngày tải lên: 22/02/2014, 04:20

6 494 0
Data Structures and Algorithms – C++ Implementation ppt

Data Structures and Algorithms – C++ Implementation ppt

... 75 pLoc Faculty of Computer Science and Engineering – HCMUT Slide 33 General Delete Case Before 39 count 52 75 head list pPre pLoc pPre -> link = pLoc -> link recycle (pLoc) 39 count recycled ... Faculty of Computer Science and Engineering – HCMUT Slide 32 Delete First Node Before count list head 39 52 75 pPre pLoc list.head = pLoc -> link recycle(pLoc) After count list head pPre recycled ... pPre -> link = pLoc -> link list.count = list.count - recycle (pLoc) return End deleteNode Faculty of Computer Science and Engineering – HCMUT Slide 36 Delete Node template ...

Ngày tải lên: 06/03/2014, 17:20

53 675 2
THE ANTHROPOLOGY OF ONLINE COMMUNITIES BY Samuel M.Wilson and Leighton C. Peterson doc

THE ANTHROPOLOGY OF ONLINE COMMUNITIES BY Samuel M.Wilson and Leighton C. Peterson doc

... interdisciplinary, originating many times in communication and media studies, and often called computer-mediated communication (CMC) research These scholars revealed changing communicative practices ... Social Practice Greenwich, CT: Ablex American Anthropological Association 1998 Code of Ethics of the American Anthropological Association http://www.aaanet.org/ committees/ethics/ethcode.htm Anderson ... emerging constructions of individual and collective identity; and the culturally embedded nature of emerging communicative and social practices Recently there have been calls for an ethnographic approach...

Ngày tải lên: 06/03/2014, 21:20

19 659 1
Báo cáo Y học: A novel DNA repair enzyme containing RNA recognition, G-patch and specific splicing factor 45-like motifs in the protozoan parasite Toxoplasma gondii potx

Báo cáo Y học: A novel DNA repair enzyme containing RNA recognition, G-patch and specific splicing factor 45-like motifs in the protozoan parasite Toxoplasma gondii potx

... 5¢-ATGAGAG AGGTTATCAGCATC-3¢ and 5¢-TTAGTACTCGTCAC CATAGCC-3¢; for TgDRE, 34S13 sens: 5¢-ATGCTGGA CTCTCTCTACGGGGAT-3¢ and 34AS15 antisens: 5¢-TT AGTCGAGGGGTTTGTCTGC-3¢ PCR products were electrophoresed ... Amplification Kit (Clontech) with the adaptor primer and speci c oligonucleotides N34AS 5¢-CTTCACCTGGAGGAGATTTCC AAA-3¢ for 5¢ RACE and N34S 5¢-GGGAGGGTC TCGGCGTCAACAAAC-3¢ for 3¢ RACE Nested PCR was performed ... oligonucleotides S10 5¢-GT CGAGATGTTGGTTGTCGGAGACC-3¢ for 5¢ RACE and PR2AS 5¢-GACCGTTACCACTGATTGCGGCTG 3¢ for 3¢ RACE The PCR products were cloned into the TA cloning vector (Invitrogen) which were...

Ngày tải lên: 08/03/2014, 22:20

9 421 0
Ecient Collision Detection for Animation and RoboticsMing C. LinDepartment of Electrical pptx

Ecient Collision Detection for Animation and RoboticsMing C. LinDepartment of Electrical pptx

... between convex polytopes described in Chapter and local numerical methods to extend the incremental nature to convex curved objects This approach preserves the coherence between successive motions and ... described in the next section However, the basic concept of CSG representation is used in constructing the subpart hierarchical tree to describe the nonconvex polyhedral objects, since each convex ... Chieh Lin i Abstract E cient Collision Detection for Animation and Robotics by Ming Chieh Lin Doctor of Philosophy in Electrical Engineering and Computer Science University of California at Berkeley...

Ngày tải lên: 14/03/2014, 14:20

159 296 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

... TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTCATCGTCTTTGTAGTCCATGG TGGT-3¢, respectively ... oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, into the XbaI site of pBOS Vector pBOS-Myc ... by site-directed mutagenesis, using the primers 5¢-CGTGACCACCCTGACCGCGGG CGTGCAGTGCTTC-3¢ and 5¢-GAAGCACTGCACGCC CGCGGTCAGGGTGGTCACG-3¢ pCerulean(W66A)elongin C- citrine was constructed by inserting...

Ngày tải lên: 16/03/2014, 05:20

9 421 0
Báo cáo khoa học: Microcin J25 induces the opening of the mitochondrial transition pore and cytochrome c release through superoxide generation doc

Báo cáo khoa học: Microcin J25 induces the opening of the mitochondrial transition pore and cytochrome c release through superoxide generation doc

... the 20% and the 60% acetonitrile solutions also contained 100 mm KCl and 0.1% trifluoroacetic acid (v ⁄ v) The eluted cytochrome c was detected at 393 nm Cytochrome c concentrations were calculated ... induced by MccJ25 The inhibition of swelling induced by ascorbic acid will be discussed later As a positive control, the swelling and calcein release induced by calcium, and the inhibitory effect ... Effect of different drugs on the swelling and calcein release from mitochondria induced by MccJ25 Swelling and calcein release of energized mitochondria were induced by 20 lM MccJ25 and 50 lM Ca+2...

Ngày tải lên: 16/03/2014, 06:20

9 286 0
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc

Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc

... CS060# and CS#60# Residue Carbon CS040# (p.p.m.) CS060# (p.p.m.) CS#60# (p.p.m.) DUA (C) C1 C2 C3 C4 C5 C6 C1 C2 C3 C4 C5 C6 CH3 C O C1 C2 C3 C4 C5 102.83 71.54 67.51 109.41 147.01 – 102.97 55.02 ... of CS is a repeating disaccharide of glucuronic acid (GlcA) and N-acetylgalactosamine (GalNAc) [-4)GlcA(b1– 3)GalNAc(b1-]n, which may be O-sulfated on the C4 and ⁄ or C6 of GalNAc and C2 of GlcA ... GalNAc residue Table Carbon chemical shift Dd values between CS040# and CS060# Residue Carbon Calculated (p.p.m.) Observed (p.p.m.) DUA (C) C1 C2 C3 C4 C5 C1 C2 C3 C4 C5 C6 +1.1 +0.9 +1.2 +0.6 +0.4...

Ngày tải lên: 16/03/2014, 14:20

11 481 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

... substitution [rSPC (FFI)] Species Numbering hSP -C rSP -C (FFI) pSP -C Cow SP -C Rat SP -C Canine SP -C Amino-acid sequence 11 21 (F) GIPCCPVHLK RLLIVVVVVV LIVVVIVGAL LMGL L GIPFFPVHLK RIPCCPVNLK RLLIVVVVVV ... dNN(i,i+1) connectivities clearly show the a-helical structure of rSP -C (FFI) In addition, 3JNHa coupling constants are summarized, with small circles indicating couplings < 5.0 Hz and large circles ... 2g6.68 c1 .81; d0.94 c1 .71; d0.95 c1 .94, 1.20; d0.97, 0.93 c1 .17, 1.01 c1 .15, 1.00 c1 .16, 1.02 c1 .14, 1.03 c1 .15, 1.00 c1 .15, 1.00 c1 .75; d1.02, 0.94 c1 .17; d0.99 c1 .16, 0.99 c1 .17, 1.02 c1 .17,...

Ngày tải lên: 16/03/2014, 16:20

10 426 0
Developing and Porting C and C++ Applications on Aix pdf

Developing and Porting C and C++ Applications on Aix pdf

... nodelock license server Concurrent network license server Chapter C and C+ + compilers 23 A concurrent nodelock license server supports concurrent nodelock product licenses A concurrent nodelock license ... Mark Changfoot, Paul Pacholski, Rene Matteau xxiv Developing and Porting C and C+ + Applications on AIX Chapter C and C+ + compilers This chapter focuses on the latest versions of the IBM C and C+ + ... write characters that are not in the basic character set You can have universal characters in identifiers, string literals, and comments Developing and Porting C and C+ + Applications on AIX func...

Ngày tải lên: 17/03/2014, 13:20

546 2,6K 0
C#1 introduction to programming and the c language potx

C#1 introduction to programming and the c language potx

... 10 Excellent Economics and Business programmes at: Please click the advert “The perfect start of a successful, international career.” CLICK HERE to discover why both socially and academically ... Perimeter and area of a circle As an example I will show an application, where the user must enter the radius of a circle, and the program calculates and writes the circle’s circumference and area ... text document that contains all the necessary commands his document is called the programs code or source code he individual commands must be written in a very precise way, that the computer can...

Ngày tải lên: 18/03/2014, 02:20

30 539 0
Richard reese  -  understanding and using c pointers

Richard reese - understanding and using c pointers

... system implicitly, such as when memory is allocated for automatic variables In this case, variables are allocated to the enclosing function’s stack frame In the case of static and global variables, ... variations This can have a significant impact on how memory is allocated and used x | Preface Chapter 2, Dynamic Memory Management in C Dynamic memory allocation is the subject of Chapter The standard ... activity can result in memory leaks and dan‐ gling pointers Alternative deallocation techniques, including garbage collection and exception handlers, are presented Chapter 3, Pointers and Functions...

Ngày tải lên: 19/03/2014, 14:12

226 650 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

... reversed-phase HPLC with 214 nm UV detection on a YMC˚ Pak ODS C1 8, 120 A, lm (4.6 · 150 mm) (Schermbeck, Germany) column using 0.1% trifluoroacetic acid in water (A) and 0.08% trifluoroacetic acid in acetonitrile ... trypsin and chymotrypsin) was measured at 1.0 lm substrate and 2.0–50 nm protease concentration, and the specificity constants (kcat ⁄ Km) were obtained from the corrected initial reaction rates ... PrtA activity The kcat ⁄ Km values are calculated from initial reaction velocities (see Experimental procedures) at 1.0 lM Dabcyl–EVYAVES–Edans substrate and 0.2 nM enzyme concentrations Each point...

Ngày tải lên: 23/03/2014, 09:20

11 425 0
Báo cáo khoa học: "FSA: An Efficient and Flexible C++ Toolkit for Finite State Automata Using On-Demand Computation" ppt

Báo cáo khoa học: "FSA: An Efficient and Flexible C++ Toolkit for Finite State Automata Using On-Demand Computation" ppt

... depth-first search (DFS), single-source shortest path (SSSP), connect (only keep accessible and coaccessible state), strongly connected components (SCCs) • operations on relations of sets compose (filtered), ... depthfirst search (DFS) and the computation of strongly connected components (SCC) Efficient versions of these algorithms are described in (Mehlhorn, 1984) and (Cormen et al., 1990) It is very costly ... M Pasto, D Pico, A Sanchis, E Vidal and J.M Vilar, 2001, Speech-to-Speech Translation based on Finite-State Transducer, In Proc IEEE Int Conf on Acoustics, Speech and Signal Processing, pp 613-616,...

Ngày tải lên: 23/03/2014, 19:20

8 423 0
Báo cáo Y học: Characterization of four substrates emphasizes kinetic similarity between insect and human C-domain angiotensin-converting enzyme pptx

Báo cáo Y học: Characterization of four substrates emphasizes kinetic similarity between insect and human C-domain angiotensin-converting enzyme pptx

... la Recherche Medicale, Paris) Cell culture and ACE purification were as described [16] Purification of Locusta migratoria testicular ACE was as described [10] Tissue extraction and HPLC purification ... previously [15] Purification of mammalian and insect ACE enzymes Chinese hamster ovary cells expressing recombinant human sACE, cACE and nACE were a kind gift of P Corvol and ´ A Michaud (Institut ... Fractions according to absorbance peaks were manually collected; (c) PKB 100 column (Supelco, PKB 100, 4.6 · 250 mm, lm), elution and collection as (b); (d) Hypercarb column (Thermoquest, Hypercarb,...

Ngày tải lên: 24/03/2014, 03:21

9 405 2
w