dcf as a measuring tool

... Plan Marketing - www.actionplan.com Speaking as a Marketing Tool 11 Robert Middleton Interviews Vickie Sullivan speaking as a marketing tool can really create some wonderful and qualified leads ... you, that’s a clue That’s a clue that they are not taking this seriously, that they are not going to help you and you can always back out You can always say, “I am so thrilled that you are pleased ... death because when you say speaker that has such a connotation that they start turning you off You don’t say, “I’m an author, I’m a speaker, I’m a business coach,” you say, “I am a strategic advisor...

Ngày tải lên: 16/01/2014, 22:20

... students, and community associations The program worked by offering discounted bus passes to individuals who purchased passes as part of a larger group-purchasing program The discount pass acted as an ... Community-Based Social Marketing as a Planning Tool local, state, and federal government agencies” (Global Action Plan) The U.S program is part of a larger international effort that is operating in ... 18.4% Strangers Other Page 32 5.3% 7.9% September/2002 Community-Based Social Marketing as a Planning Tool Community-Based Social Marketing as a Planning Tool September/2002 Page 33 Chapter Case Studies...

Ngày tải lên: 29/03/2014, 23:20

... WWW.STRATEGY of G I V I N G C O M Giving
initiates a movement.
 A company
that
has
 generated
movement
 in
the
recipients
can
then
 direct
this
energy SoG WWW.STRATEGY of G I V I N G C O M A company
that
gives ... most
visible.
At
the
same
 time,
it
is
the
hardest WWW.STRATEGY of G I V I N G C O M Giving
process
is
 only
actualized
 when
the
receiver
 accepts
it WWW.STRATEGY of G I V I N G C O M Receiving a gift
always
 ... SoG WWW.STRATEGY of G I V I N G C O M How
can
this
be
 turned
into
 a strategy? SoG WWW.STRATEGY of G I V I N G C O M Think backwards WWW.STRATEGY of G I V I N G C O M WWW.STRATEGY of G I...

Ngày tải lên: 14/06/2014, 14:14

... Hospital Anxiety and Depression Scale (HADS, anxiety domain), and the WHO-DAS II disability questionnaire was calculated Concordance between classification criteria was assessed by inter-rater agreement ... Vindel A: Trastornos de ansiedad, Sociedad Española para el estudio de la Ansiedad y el Estrés (SEAS) 2005http://www.ucm.es/info/ seas/ta/index.htm, (last update: March 7th, 2005; last accessed: ... and to assess the efficacy of psychosocial and psychopharmacological interventions in these patients Many health questionnaire-based instruments allowing clinicians to approach GAD at any healthcare...

Ngày tải lên: 18/06/2014, 19:20

... large physical movements as occurs during flight simulations [27] and gaming We have also observed measurable increases in the variability of head and trunk coordination and increased lateral ... NeuroEngineering and Rehabilitation 2004, 1:13 the remote collaborator (this often is referred to as an avatar); the video and/or audio channel (that facilitates face-to-face conversation.) Video has limited ... of the available fiber has been lit, and each fiber has several terabits/s of capacity The dot-com implosion has made this dark fiber and wavelengths of light in the fiber, very affordable The...

Ngày tải lên: 19/06/2014, 10:20

... heritage and art forms, local festivals, road drives and activities for children As (1) asserted that it is important to measure consumer satisfaction applying as many destination attributes as ... of their ways of living Aranmula is famous for its ‘metal mirror’ and boat race There are also institutions like the Vaastu Vidya Gurukulam, which gives training in vaastu shastra and a school ... K.,“Tourism: It’s about managing competitiveness, too”, International Trade Forum, 1, 2003 w w w i j m b s c o m [39] Bindu Narayanan, Chandrasekharan Rajendran, Prakash Saia, L, Ram Gopalan,“Dimensions...

Ngày tải lên: 01/08/2014, 10:25

... implantation and clinical pregnancy rate may have been Micromanipulation as a Clinical Tool 301 increased following laser-mediated assisted hatching and a relatively large group of healthy babies ... children) was also diagnosed at 18 months in a ooplasmic Micromanipulation as a Clinical Tool 289 transfer infant, a boy from a mixed sex twin Other centers applying ooplasmic transplantation have not ... than 20 babies There are a number of ways to transplant ooplasm, but the one initially used was a minor modification of the standard clinical ICSI technique A small portion of ooplasm was transferred...

Ngày tải lên: 05/08/2014, 16:20

... rebmun A la te sisylana DPAR aidnI ,ragantazI ,etutitsnI hcraeseR yranireteV naidnI ,yrotarobaL airetcabocyM eht ta muidem nesneJ-nietsnewoL no deniatniam dna ]62[ stset lacimehcoib dna )gniniats ... sisylana )DPAR( AND cihpromylop deifilpma modnar yb sniarts )CEPA( iloc E cinegohtap naiva fo noitaitnereffiD B S nosnevS ,J najayeerpisaS ,P atoosamaR ,N iahcnropirisnahC 49-58 ,3 ,1991 lppA sdohteM ... gniraeppa dnab AND a fo )0( ecnesba ro )1( ecneserp fo sisab eht no tliub saw dna slaremun eht fo desopmoc xirtam atad A hpargotohp a no deton erew DPAR yb deniatbo snrettap gnidnab ehT )ynamreG...

Ngày tải lên: 07/08/2014, 18:21

... compare a clinician-assessment with a self-report, we did not consider it imperative that parental collateral be obtained Previous studies have noted that parents may not always be aware of what ... Stellenbosch and Cape Town Consent from the heads of schools, parent bodies, and parents and learners was also obtained Learners and their parents/guardians were informed that participation was entirely ... for categorical data Cohen's kappa coefficients (K) were used to measure the level of agreement between the measures As initial analysis revealed a statistically significant difference and low...

Ngày tải lên: 08/08/2014, 21:20

... Formal Consensus Process Ana Arrobas Ana Todo-Bom Ângela Gaspar Aurora Carvalho Carlos Alves Carlos Lopes Fernando Calvário Authors' contributions LNS participated in data collection, analysis and ... Inácio Filomena Falcão Gra a Castelo-Branco Jaime Correia-Sousa João Almeida Fonseca José Costa Trindade José Dias-Pereira José Moreira-Silva Additional material Josefina Rodrigues Additional file ... A, Specchia C, Passalacqua G, Venturi S, Braido F, Bonini S, Majani G, Canonica GW: Rhinasthma: A new specific QoL questionnaire for patients with rhinitis and asthma Allergy: European Journal...

Ngày tải lên: 12/08/2014, 14:20

... the AYMH scale has reasonably good construct validity and internal consistency However, the scale has moderate discriminatory capabilities as a diagnostic tool for depression and anxiety Compared ... check the equality of variance assumption Internal consistency of the scale was evaluated using Cronbach’s alpha As for validity analysis, the diagnostic assessment of depression and anxiety by ... this article as: Mahfoud et al.: Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children Child and Adolescent Psychiatry and Mental Health...

Ngày tải lên: 13/08/2014, 18:21

... the authority (REMA) Quality of the EIAs   on the basis that EIA is still new in Rwanda , the latter has been encouraging as many individuals as possible to participate in carrying out EIAs, ... Rwanda   Under the present legislation, several government departments, private companies, and parastatal organisations undertake EIAs; that some forms of environmental assessments have occasionally ... environmental Organic law No 04/2005 of 08/04/200 (2005;  established Rwanda Environmental Management Authority (REMA), to coordinate and oversee all aspects of environmental management for sustainable...

Ngày tải lên: 15/04/2015, 09:16

... instantly ge sa es m nd se to y wa ick qu a s ay Email was alw munication tool     m co ce fi of rd da an st e th e Then it becam And the headaches began Photo by hitsnooze - Creative Commons Attribution-ShareAlike ... ne an ch d an ol to n tio bo lla co ain m Should this be the Watch this video on the ways email is failing us as a collaborative tool Photo by luc legay - Creative Commons Attribution-ShareAlike ... Facebook notifications And SPAM   Photo by Lars Plougmann - Creative Commons Attribution-ShareAlike License https://www.flickr.com/photos/75062596@N00 And now, managing email is a major chore Photo...

Ngày tải lên: 27/11/2015, 12:22

... pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than the regular aroma sample ... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... a small food reward after the last evaluation session Samples The sample material was a fermented oat bran product (Yosaw, Bioferme, Finland), which is a cereal-based snack food similar to flavored...

Ngày tải lên: 03/04/2013, 21:06

... Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also ... association of the variable heavy chain (VH) with protein A was used as a surrogate for direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical ... denaturant as a selective pressure to The potential for obtaining quantitative biophysical information from phage-display was suggested by a new method called alanine shotgun scanning, which analyzes...

Ngày tải lên: 19/02/2014, 12:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...

Ngày tải lên: 19/02/2014, 17:20

... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers ... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classification by LDA Classification by LDA on spectra reduced by PCA PCA was performed on the training...

Ngày tải lên: 21/02/2014, 03:20

Ngày tải lên: 19/03/2014, 00:20

... those  measures  that  are  being  used  in the target areas as well as foreign countries,  such  as Indonesia,  China,  Bangladesh,  Germany,  Mexico,  Colombia,  USA.  Some  of  them are introduced as follows.  ... Table 7. Standardized score for costs of combinations  Measure  A1 +A2 .3  A1 +B1  A1 +B2  A1 +B1+B2  A2 .1 +A2 .3  A2 .1+B1  A2 .2 +A2 .3  A2 .2+B1  A2 .3+B1  A2 .3+B1+B2  Standardized cost  Standardized score ... doing so, the consensus on the problems and  their solutions can be reached. However, it is  noted that MCA is subjective in its nature. In  case  the  quantitative  data  are  available,  quantitative  analysis  (i.e.  numerical ...

Ngày tải lên: 22/03/2014, 12:20

... similar to aromatic DNA-intercalating agents Although DNA is the most important biological assembly stabilized by aromatic interactions [56], a diverse group of planar aromatic compounds can intercalate ... information of the role of aromatic moieties in amyloid fibril formation [36–41] A parameter-free model based on the mathematical analysis of many peptide fragments and their analogues had clearly ... formation E Gazit case a central aromatic region was identified by the nonbiased peptide scan [22] Interestingly, the same motif was independently identified when analyzing peptide fragments [49] As...

Ngày tải lên: 23/03/2014, 11:20