d servetto and g barrenechea constrained random walks on r
Orbits of rotor router operation and stationary distribution of random walks on directed graphs
... the rotor-router model on a strongly connected digraph G in which the cyclic orderings are relaxed This variant can be considered as an intermediate model between the random walk and the rotor-router ... connected digraph This section is devoted to a proof for Theorem Background on rotor-router model and random walk In this paper all digraphs are assumed to be loopless, and the multi-edges are allowed ... digraphs Gn has the desired property Random walks on set of single-chip -and- rotor states In this section we work with a strongly connected digraph G = (V, E) We consider a natural non-deterministic...
- 16
- 207
- 0
Tài liệu Báo cáo khoa học: "Answering Opinion Questions with Random Walks on Graphs" docx
... 2005 Using random walks for questionfocused sentence retrieval In HLT/EMNLP Lawrence Page, Sergey Brin, Rajeev Motwani, and Terry Winograd 1998 The pagerank citation ranking: Bringing order to the ... opinion question answering and summarization tasks (draft) In TAC G nes Erkan and Dragomir R Radev 2004 Lexu pagerank: Prestige in multi-document text summarization In EMNLP Andrea Esuli and Fabrizio ... first construct a directed or undirected graph to represent the relationship between sentences and then certain graph-based ranking methods are applied on the graph to compute the ranking score...
- 9
- 420
- 0
Báo cáo toán học: " Random walks on generating sets for finite groups" docx
... electronic journal of combinatorics 4, no (1997), #R7 14 [5] P Diaconis, R L Graham and J A Morrison, Asymptotic analysis of a random walk on a hypercube with many dimensions, Random Structures and ... when G = Z2 References [1] David Aldous, talk at 1994 National IMS meeting [2] F Celler, C R Leedham-Green, S Murray, A Niemeyer and E A Obrien, Generating random elements of a finite group, ... Comm Alg., 23 (1995), 4931–4948 [3] F R K Chung, Spectral Graph Theory, Amer Math Soc., Providence, RI (to appear 1996) [4] F R K Chung and R L Graham, Stratified random walk on an n-cube, preprint...
- 14
- 330
- 0
A study of hitting times for random walks on finite, undirected graphs
... endeavor 3 C ONTENTS Introduction A Theoretical Foundation for Random Walks and Hitting Times 2.1 Understanding Random Walks on Graphs in the Context of Markov Chains 2.2 Interpreting Hitting ... times for random walks on this class of graphs Result 2.15 Assume vertices i and j are adjacent Consider a random walk starting at vertex j on an n-vertex k-regular undirected graph G Then Ej ... observations about random walks on graphs and allows us to move toward our goal of calculating expected hitting times for random walks on finite graphs The reader is instructed to see the literature...
- 49
- 224
- 0
Thuật ngữ về Thương mại điện tử vần D,E,F,G
... tập đồ họa GIF sử đụng để g i hiển thị tập đồ họa mạng GUI (Graphical User Interface) Giao diện người sử d ng đồ họa - Một giao diện cho phép người sử d ng điều hướng tương tác với thông tin hình ... hàng Gateway Cổng mạng - Phần mềm hay phần cứng nối hai ứng d ng hay mạng lẽ không tương thích cho truyền liệu máy tính khác GIF (Graphics Interchange Format) GIF - Một chế độ nén khuôn d ng tập ... Internet để đột nhập vào thông tin Floppy Disk (diskette) Đĩa mềm - Là phương tiện lưu trữ từ tính sử d ng để lưu trữ chuyển liệu Form Biểu mẫu - Các trang web bao g m text trường để người sử d ng...
- 3
- 1,085
- 0
Hydraulic modeling of open channel flows over an arbitrary 3-d surface and its applications in amenity hydraulic engineering
... would like to convey my deepest gratitude and sincere thanks to Professor Dr Takashi Hosoda who suggested me this research topic, and provided guidance, constant and kind advices, encouragement ... depth-averaged model in Cartesian coordinates and introduced the curved river boundary to the model through steps Tingsanchali and Mahesawaran (1990) presented a mathematical depth-averaged model for ... modeling of meandering channels with generalized depth averaged model J Hydr Engrg., ACSE, Vol 131(6), pp 467-475 31 Zhou J G. , Causon D M., Mingham C G and Ingram D M 2004 Numerical prediction...
- 127
- 595
- 0
Phân biệt giữa PhD, D.Eg and D.Sc
... chung luận án Doctor nauk thường nghiêng lý thuyết hàn lâm Nhiều người bảo vệ xong già hết chả cống hiến cho xã hội Có người vừa nhận xong lăn đùng chết Cũng học sinh VN ta học phổ thông sức để chả ... bảo vệ Ngoài ra, người muốn có học vị Doctor nauk giáo viên hướng d n (Rukovodichel hay Supevisor), phải tự "mở lối" cho Có thể bảo vệ Doctor nauk luận án (kèm theo báo) sách viết Nói chung khó ... tiếng vào" luận án d ng không cho phép tinh thần "quốc tế vô sản" thời LX cũ hay định hướng "mở r ng thị trường đào tạo quốc tế" Liên bang Nga Tất nhiên trường lớn GS uy tín không đời chịu nhận NCS...
- 3
- 910
- 1
Tài liệu Thuật ngữ về TMĐT vần D,E,F,G pdf
... sử d ng để lưu trữ chuyển liệu Form Biểu mẫu - Các trang web bao g m text trường để người sử d ng điền thông tin FTP (File Transfer Protocol) Giao thức truyền tệp - Một phương pháp thông d ng ... truyền liệu máy tính khác GIF (Graphics Interchange Format) GIF - Một chế độ nén khuôn d ng tập đồ họa GIF sử đụng để g i hiển thị tập đồ họa mạng GUI (Graphical User Interface) Giao diện người ... chương trình Các tệp thi hành DOS hay Windows thường có đuôi e xe hay com Trong môi trường UNIX Macintosh, tiệp thi hành có tên External Viewer Trình xem bên - Một phần mềm bổ sung giúp trình duyệt...
- 3
- 471
- 0
Tài liệu Đề tài " Cover times for Brownian motionand random walks in two dimensions " pdf
... P Revesz, Random Walk in Random and Non -Random Environments, World Scientific Publ Col, Teaneck, NJ (1990) [27] D Revuz and M Yor, Continuous Martingales and Brownian Motion, Springer-Verlag, ... [21] G Lawler, On the covering time of a disc by a random walk in two dimensions, in [22] R Lyons and R Pemantle, Random walks in a random environment and first-passage (Seminar in Stochastic Processes ... Nonlinear Analysis on Manifolds Monge-Amp`re Equations, Springere Verlag, New York, 1982 [9] S Axler, P Bourdon, and W Ramey, Harmonic Function Theory, Grad Texts in Math 137, Springer-Verlag,...
- 33
- 397
- 0
Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf
... (FPI) and director of FPI’s Immigration Research Initiative James Parrott, FPI’s chief economist and deputy director, provided constant support and research guidance The report was prepared under ... Ireland Haiti Egypt/United Arab Rep Iraq Honduras Nicaragua South Africa Portugal Turkey France Thailand Trinidad and Tobago Guyana/British Guiana Syria Jordan All other foreign-born U.S.-born ... Pharmacies and drug stores Miscellaneous general merchandise stores Building material and supplies dealers Sporting goods, camera, and hobby and toy stores Auto parts, accessories, and tire stores...
- 37
- 436
- 0
Tài liệu Báo cáo khoa học: Enzymes for the NADPH-dependent reduction of dihydroxyacetone and D-glyceraldehyde and L-glyceraldehyde in the mould Hypocrea jecorina doc
... to convert d- glyceraldehyde and l-glyceraldehyde to glycerol d- Glyceraldehyde is an intermediate in the catabolic path for d- gluconate [7] and d- galactonate [8] l-Glyceraldehyde is an intermediate ... dehydrogenases in mould The previously purified enzymes showed activity with glycerol and NADP in the oxidizing direction and activities with DHA or d- glyceraldehyde and NADPH in the reducing direction ... extracts for activity with l-glyceraldehyde or d- glyceraldehyde and NADPH We observed similar activities on all carbon sources, suggesting that GLD1 is not induced by d- galacturonic acid (data...
- 7
- 510
- 0
Tài liệu Báo cáo khoa học: "Identifying Text Polarity Using Random Walks" pptx
... Algorithm Word Polarity using Random Walks Require: A word relatedness graph G 1: Given a word w in V 2: Define a random walk on the graph the transition probability between any two nodes i, and ... while synonyms of negative words and antonyms of positive words are considered negative A similar method is presented in (Andreevskaia and Bergler, 2006) where WordNet synonyms, antonyms, and glosses ... first-passage (hitting) time above, 398 we now propose our word polarity identification algorithm We begin by constructing a word relatedness graph and defining a random walk on that graph as described...
- 9
- 450
- 0
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc
... (An engineered EcoRI recognition site is single-underlined The start codon is double-underlined The modified original start codon of M2 is dot-underlined The engineered region containing mycepitope ... 5¢-CATTATAAGA ACATAGGCGCTACAAGGATGGGTTGTACCATGTC ACAGGAAG-3¢; M2-goa1-PstI-as, 5¢-CCAATGCATTGG TTCTGCAGTTAATACAAGCCGCATCCACGAAGA-3¢ (An engineered PstI recognition site is single-underlined The overlapping ... N-terminal region (aN–a1), the aF–aG region and the C-terminal region (a4–a5) were well conserved between GOA-1 and Gao [31,32] The five regions of the Ga-subunit involved in receptor recognition are...
- 9
- 400
- 0
Herpesviridae – A Look into This Unique Family of Viruses Edited by George D. Magel and Stephen Tyring docx
... herpesvirus-induced DNA damage response is not the recognition of viral DNA as double-strand breaks, or actual damage to DNA, but is the recruitment of DNA damage repair factors observed during viral ... PRDII site binds NF-кB heterodimers, while PRDIV binds ATF-2 and cJun heterodimers Upon binding to the promoter region by the different activated transcription factors, and the high-mobility group ... Nascimento and R. M.E Parkhouse Instituto Gulbenkian de Ciência Portugal Introduction Herpesviruses are a large group of successful, and widely distributed, double-stranded DNA viruses of serious medical...
- 330
- 1,753
- 0
Green Functors and G-sets~ pdf
... permission for use must always be obtained from Springer-Verlag Violations are liable for prosecution under the German Copyright Law Springer-Verlag Berlin Heidelberg 1997 Printed in Germany The ... or part of the material is concerned, specifically the rights of translation, reprinting, re-use of illustrations, recitation, broadcasting, reproduction on microfilms or in any other way, and ... theory of Green functors for the trivial group is the theory of ordinary rings Now ring theory gives a series of directions for possible generalizations, and I will treat some cases here (tensor...
- 342
- 354
- 0
Báo cáo Y học: Monitoring the structural consequences of Phe12 fi D-Phe and Leu15 fi Aib substitution in human/rat corticotropin releasing hormone Implications for design of CRH antagonists pdf
... for helical ( ) and b-strand (m) configurations (D) Number of meaningful NOE constraints per residue for [D- Phe12, Aib15]CRH used in the structural calculations White, grey, and dark grey bars represent, ... difference analysis between the observed CaH shift values and the corresponding random coil values is presented in Fig 2B (lower panel) and provides strong evidence for the conformational preference ... ACKNOWLEDGEMENTS General Secretariat of Research and Technology of Greece (P.C) and Marie Curie Research Training Grant – Contract No HPMF-CT1999-00344 (G. A.S) are acknowledged for financial support...
- 11
- 515
- 0
UNDERSTA N D I N G PROSTATE CHANGES: A HEALTH GUIDE FOR MEN pot
... or condition that stays bad or gets worse over a long period of time DRE: DRE stands for digital rectal exam An exam where a doctor puts a lubricated, gloved finger into the rectum to feel for ... with urine or the organs of the body that produce and get rid of urine urine (YOOR-in): Fluid containing water and waste products Urine is made by the kidneys, stored in the bladder, and leaves ... faced similar decisions There are many organizations that can provide more information and support to you, your partner, and family It is a good idea to get a copy of your pathology report from...
- 21
- 234
- 0
Báo cáo khoa học: Polyamines interact with DNA as molecular aggregates Luciano D’Agostino1 and Aldo Di Luccia doc
... epidermoid oropharingeal carcinoma, PCCl3 rat thyroid and NA101 chicken embryo chondrocyte transformed by RSV These cells were cultured in the recommended standard conditions and used when preconfluent ... separated by electrophoresis for h using the conditions described above Each gel was photographed with a Polaroid MP-4 L camera and migration distances were measured with a ruler from photographs ... separation range and, for this reason was marked as < 1000 Da Compelling variations in GPC peaks were recorded after 2, 4, and 12 h of gastrin treatment The chromatograms at time showed two minor...
- 9
- 282
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25