cycle apoptosis and transcription regulators in t all

Báo cáo khoa học: Huntington’s disease: roles of huntingtin-interacting protein 1 (HIP-1) and its molecular partner HIPPI in the regulation of apoptosis and transcription pptx

Báo cáo khoa học: Huntington’s disease: roles of huntingtin-interacting protein 1 (HIP-1) and its molecular partner HIPPI in the regulation of apoptosis and transcription pptx

... regulation of transcription and apoptosis by HIPPI and HIP-1 in HD Interaction of HIP-1 with the wild-type Htt allele is stronger than that of the mutated Htt [17] In HD, one of the alleles of Htt ... mediated apoptosis and transcription N P Bhattacharyya et al protein–protein interactions, are present at the N-terminal region of the protein Wild-type Htt is localized at the endoplasmic reticulum, ... death effector domain-associated factor, belongs to a family of small zinc finger-containing proteins that participate in transcriptional regulation by binding with other transcription factors...

Ngày tải lên: 23/03/2014, 07:20

9 492 0
Báo cáo khoa học: Tec family kinases Itk and Rlk⁄ Txk in T lymphocytes: cross-regulation of cytokine production and T-cell fates pot

Báo cáo khoa học: Tec family kinases Itk and Rlk⁄ Txk in T lymphocytes: cross-regulation of cytokine production and T-cell fates pot

... associated with increased in ammation and Th1 cytokine production [4] These results suggest that Tec kinases contribute to human diseases involving distinct types of T- cell activation and cytokine ... -3 protein interaction domains that are important for kinase regulation, and a Tec homology domain containing one or two proline-rich regions that interact intra- or intermolecularly with Src ... cytokine and TCR signaling may affect regulatory T- cell differentiation, it will be of interest to see the role of the TFKs in regulating the differentiation of this subset Together, these studies...

Ngày tải lên: 28/03/2014, 22:21

10 312 0
Báo cáo y học: "Intra-articular injection of recombinant TRAIL induces synovial apoptosis and reduces inflammation in a rabbit knee model of arthri" pdf

Báo cáo y học: "Intra-articular injection of recombinant TRAIL induces synovial apoptosis and reduces inflammation in a rabbit knee model of arthri" pdf

... addition to inducing apoptosis of the synovium, intra-articular injection of exogenous TRAIL protein reduced the leukocytic infiltrate into the inflamed joints, indicating that TRAIL may inhibit ... staining; and 4+, extensive staining Student's t test was used for a statistical analysis rTRAIL, recombinant TRAIL protein sis in rTRAIL treated joints relative to control joints (Table 1) The ... greater than 50% compared to the saline control (Figure 1b), suggesting that rTRAIL can inhibit the leukocytic infiltrate into the joint space or can induce apoptosis of the infiltrating cells rTRAIL...

Ngày tải lên: 09/08/2014, 07:20

8 418 0
Báo cáo y học: "Glomerular matrix metalloproteinases and their regulators in the pathogenesis of lupus nephritis" pdf

Báo cáo y học: "Glomerular matrix metalloproteinases and their regulators in the pathogenesis of lupus nephritis" pdf

... facilitates substrate binding MMP, matrix metalloproteinase by direct interaction between the two proteins within the nucleus [31] The concept of TIMP-1 translocating into the nucleus remains controversial ... neutrophils As part of this inflammatory process, several MMPs and TIMPs are secreted by activated infiltrating cells and by cells intrinsic to the inflamed site, facilitating penetration into the ... prodomain interacts with zinc to prevent substrate binding The haemopexin domain mediates interaction with enzyme substrates Specific to the gelatinases is the fibronectin-like domain, which further...

Ngày tải lên: 09/08/2014, 13:22

8 493 0
Báo cáo y học: "Advanced glycation end products induce cell cycle arrest and proinflammatory changes in osteoarthritic fibroblast-like synovial cells" doc

Báo cáo y học: "Advanced glycation end products induce cell cycle arrest and proinflammatory changes in osteoarthritic fibroblast-like synovial cells" doc

... continues and leads to functional and structural impairment of the joints Competing interests The authors declare that they have no competing interests Authors' contributions FLS are an integral ... significantly upregulated after two to seven days of AGE-BSA treatment compared with Co-BSA incubation To investigate the protein release of both cytokines into the culture supernatants, ELISA ... differentiation and formation [41] In addition, AGE-BSA totally inhibited osteoclastogenesis in rabbit and mouse osteoclasts [42] These findings support our data that AGE-BSA plays an important role...

Ngày tải lên: 09/08/2014, 14:22

19 395 0
Báo cáo y học: " Cross-talk between cd1d-restricted nkt cells and gδ cells in t regulatory cell response" ppt

Báo cáo y học: " Cross-talk between cd1d-restricted nkt cells and gδ cells in t regulatory cell response" ppt

... Studies investigating oral tolerance to nickel demonstrated that antigen presenting cells interact with type NKT cells through CD1d causing the NKT cells to secrete IL-4 and IL-10 and activate ... liver and bone marrow T cells but are generally absent in intestinal epithelial lymphocytes (IEL) [134] In contrast, gδ concentrate in epithelia of skin, intestine and reproductive tract where these ... correlated with accumulation of intracellular viral protein and interruption of CD1 recycling pathway However, other studies demonstrate that activating TLR7/8, TLR recognizing single strand RNA and RNA...

Ngày tải lên: 11/08/2014, 21:21

9 324 0
Báo cáo y học: "Single amino acid change in gp41 region of HIV-1 alters bystander apoptosis and CD4 decline in humanized mice" potx

Báo cáo y học: "Single amino acid change in gp41 region of HIV-1 alters bystander apoptosis and CD4 decline in humanized mice" potx

... results seen with the apoptosis marker Taken together, these findings suggest that V38E mutant is replication competent, yet deficient in inducing bystander apoptosis due to the limited fusion activity ... replicates in humanized mice without reverting to WT Our hypothesis is that the point mutation in gp41 restricts the Env fusogenic activity and consequently bystander apoptosis and CD4 decline in ... find that V38E mutant is incapable of inducing bystander apoptosis in the presence of significant infection and replication in SupT1 cell line Interestingly bystander apoptosis is seen quiet...

Ngày tải lên: 11/08/2014, 21:21

13 337 0
Roles of microtubules and microtubule regulators in collective invasive migration of drosophila border cells

Roles of microtubules and microtubule regulators in collective invasive migration of drosophila border cells

... actin cytoskeleton As the centrosome repositions towards the leading edge, microtubules emanate and grow towards the periphery, where they interact with the cortical actin network In migrating ... leading to stabilization of microtubules in the leading edge Such interactions represent an important aspect of the cross-talk between the actin and microtubule cytoskeletons, and are expected to ... migration, the cell must adhere to and dynamically interact with the substrate on which it migrates to generate traction for movement If it is a guided migration, the cell must also interpret guidance...

Ngày tải lên: 09/09/2015, 10:14

156 270 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... Real-time TTCCAGTCCCGGTATATGCT Real-time TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...

Ngày tải lên: 16/02/2014, 09:20

20 690 0
báo cáo khoa học: "Regulation of cell cycle transition and induction of apoptosis in HL-60 leukemia cells by lipoic acid: role in cancer prevention and therapy" ppt

báo cáo khoa học: "Regulation of cell cycle transition and induction of apoptosis in HL-60 leukemia cells by lipoic acid: role in cancer prevention and therapy" ppt

... pivotal role in controlling the phosphorylation status of Rb, which in turn activate transcription factor E2F to induce cell entry into the S-phase Results in Fig 2B show that LA treatment caused ... elicited effects [14,19] Taken together, these results not only reinforce the essential role of LA in cell cycle control but are likely to be directly involved in contributing to its therapeutic ... limitations mentioned above, it is important to point out a significant finding in this study, i.e., the demonstration of translocation of two proteins, respectively, AIF and cytochrome c from mitochondria...

Ngày tải lên: 10/08/2014, 22:20

8 525 0
Báo cáo y học: " A balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and Pot1 in resting, activated, HTLV-1-transformed and Tax-expressing human T lymphocytes" pot

Báo cáo y học: " A balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and Pot1 in resting, activated, HTLV-1-transformed and Tax-expressing human T lymphocytes" pot

... 5'-GTTGTATGAGTGATTGGCGGGGTAA-3' and antisense, 5'-TGTTTGGAGACTGTGTACAAGGCG-3', hTERT sense, 5'-TGTTTCTGGATTTGCAGGTG-3' and antisense, 5'-GTTCTTGGCTTTCAGGATGG-3', Pot1 sense, 5'TGGGTATTGTACCCCTCCAA-3' ... Primary T Lymphocytes Activated Resting Pot1 TRF1 TRF2 hTERT Pot1 TRF1 TRF2 hTERT Tax-expressing T Lymphocytes C91PL TSP/HAM DCH-4 Pot TRF2 TRF2 Pot hTERT hTERT Pot TRF2 hTERT Figure A model for hTERT ... balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and POT1 in normal, activated as well as in HTLV-1 infected and in Tax-expressing T lymphocytes They therefore...

Ngày tải lên: 13/08/2014, 09:21

10 281 0
Báo cáo y học: "Two discrete events, human T-cell leukemia virus type I Tax oncoprotein expression and a separate stress stimulus, are required for induction of apoptosis in T-cells" pptx

Báo cáo y học: "Two discrete events, human T-cell leukemia virus type I Tax oncoprotein expression and a separate stress stimulus, are required for induction of apoptosis in T-cells" pptx

... line In an attempt to better understand HTLV-I biology, we sought to define the requirements for Tax to cause apoptosis in a Jurkat T- cell line We used JPX-9, a stable transfectant of Jurkat in ... equilibrium to favour the latter Results Zinc, but not cadmium, treatment induces apoptosis in JPX-9 cells To examine the effect of Tax on the growth/death of Jurkat cells, we studied its induction ... Western blotting Jurkat and JPX-9 cells were treated with ZnCl2 or CdCl2 for 24 hours, and the indicated proteins were detected using specific anti-sera Ratio is the band intensity in treated...

Ngày tải lên: 13/08/2014, 13:20

12 240 0
Báo cáo y học: "CCR3, CCR5, CCR8 and CXCR3 expression in memory T helper cells from allergic rhinitis patients, asymptomatically sensitized and healthy individual" docx

Báo cáo y học: "CCR3, CCR5, CCR8 and CXCR3 expression in memory T helper cells from allergic rhinitis patients, asymptomatically sensitized and healthy individual" docx

... cell Th: T helper TTx: Tetanus toxoid Competing interests The author(s) declare that they have no competing interests Authors' contributions All authors participated in the design of the study ... conducted the patient contact and characterization, cell isolation and stimulation assays MH conducted the flow cytometry and analyzed the data All authors contributed towards the manuscript preparation ... patients with atopic dermatitis and healthy controls, but in disagreement with other findings showing decreased percentage of CCR5+ and CXCR3+ memory Th cells in the blood from patients with atopic...

Ngày tải lên: 13/08/2014, 13:22

6 181 0
Báo cáo sinh học: " Protection against the allergic airway inflammation depends on the modulation of spleen dendritic cell function and induction of regulatory T cells in mice" docx

Báo cáo sinh học: " Protection against the allergic airway inflammation depends on the modulation of spleen dendritic cell function and induction of regulatory T cells in mice" docx

... and mature DCs, resulting in tolerogenic interaction with T cells in SIT We found that the combination of DNA vaccination with Fc and OVA had better effects onOVAinduced alterations in the spleen ... pathway of regulation of type immunity in asthma Competing interests The authors declare that they have no competing interests Authors' contributions YL performed all analyses and wrote the initial ... maintained in the culture medium and incubated overnight at 37°C in a 5% CO2 atmosphere After incubation, DCs with the adherence capacity in the first hours of culture become nonadherent and float in the...

Ngày tải lên: 14/08/2014, 19:22

8 258 0
Báo cáo y học: "NITRIC OXIDE (NO), CITRULLINE – NO CYCLE ENZYMES, GLUTAMINE SYNTHETASE AND OXIDATIVE STRESS IN ANOXIA (HYPOBARIC HYPOXIA) AND REPERFUSION IN RAT BRAIN"

Báo cáo y học: "NITRIC OXIDE (NO), CITRULLINE – NO CYCLE ENZYMES, GLUTAMINE SYNTHETASE AND OXIDATIVE STRESS IN ANOXIA (HYPOBARIC HYPOXIA) AND REPERFUSION IN RAT BRAIN"

... hypoxic injury to the developing cerebral white matter (5-8) In the CNS, the conversion of glutamate to glutamine by glutamine synthetase (GS; EC 6.3.1.2), that takes place within the astrocytes, ... compared to anoxia in all the brain regions tested The pattern observed for the increase in concentration of NOx in the three different brain regions was similar to that of increased NOS activity in ... glutamate and its accumulation in the extracellular space, which initiates the pathway of neuronal death known as excitotoxicity (35-36) Neuronal excitation involving the excitatory glutamate receptors...

Ngày tải lên: 26/10/2012, 09:07

8 622 0
The Retinoblastoma Gene Family in Cell Cycle Regulation and Suppression of Tumorigenesis

The Retinoblastoma Gene Family in Cell Cycle Regulation and Suppression of Tumorigenesis

... sequence, indicating that E2F might compete with the Pax proteins for binding to the pRb protein family Transient co-transfection studies showed that the pRb protein family represses transcription activation ... pocket proteins and E2Fs, it was shown that the C-terminal region of pRb contains a E2F1 specific binding site that is sufficient to inhibit E2F1 mediated apoptosis, independent of its transcriptional ... antagonist of the MDM2-mediated inactivation of pRb, since it can bind and inactivate MDM2 Therefore, it would be interesting to see whether p19ARF can disrupt the interaction between pRb and MDM2 The...

Ngày tải lên: 25/10/2013, 21:20

43 460 0
Tài liệu Use Variables and Functions in T-SQL pptx

Tài liệu Use Variables and Functions in T-SQL pptx

... Creating the T- SQL routine described in the "Technique" section, this code then assigns the routine to the Text property of the Label called lblSQLString It then creates a data adapter using the string ... and fills the dtResults DataTable Last, the code assigns the data adapter as the data source for the dgResults data grid Listing 6.5 frmHowTo6_2.vb: Storing the SQL Statement and Then Executing ... Form Then place the controls listed in Table 6.2 and seen in Figure 6.3 with the following properties set Table 6.2 Control Property Settings for This How-To Object Property Setting Label Text SQL...

Ngày tải lên: 14/12/2013, 20:16

4 548 0
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

... acts as an activating element binding E2F1, -2 and -3 These activating E2Fs cooperate with NF-Y proteins binding to CCAAT-boxes and with Myb proteins associating with a distal Myb site in activating ... activating the Cdc2 promoter Binding of the activating E2Fs during the cell cycle to the promoter alternates with binding of E2F4 in quiescent cells Mutation of the distal E2F site allows E2F4 to ... CHR-dependent transcriptional regulation, possibly through mediating protein binding to the elements, was investigated The CpG sites of the CDE in the cyclin B2 promoter were found to be partially methylated...

Ngày tải lên: 16/02/2014, 09:20

17 876 0
Tài liệu Báo cáo khoa học: Roles of AP-2 transcription factors in the regulation of cartilage and skeletal development doc

Tài liệu Báo cáo khoa học: Roles of AP-2 transcription factors in the regulation of cartilage and skeletal development doc

... motif that interacts specifically with the corepressor CtBP1 [32,33] Recently, it was shown that the broad-complex, tramtrack and bric-a-brac domain containing protein KCTD1 directly binds to ... expressed in this tissue [37–40] It would be interesting to further analyze their interactions with AP-2 and the functional role of these in chondrocytes Furthermore, it is speculated that in melanoma, ... [35,36] Little is known about the interaction of AP-2 and its binding partners in cartilage However, at least CBP ⁄ p300-interacting transactivator with ED-rich tail and protein poly(ADP-ribose) polymerase-1...

Ngày tải lên: 16/02/2014, 09:20

9 642 0
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

... protocols from Scotto-Lavio et al were used [28] First-strand cDNA synthesis was performed using the adaptor primer 5¢-CCAGTGAGCAGAGTGAC GAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTT-3¢, and then two rounds of ... (sense) and 5¢-AGCCATAGCCATAGCCACT TCC-3¢ (antisense) for exon 1a; 5¢-TAATAGGCTGCTGC TGATGAATA-3¢ (sense) and 5¢-GGTATGTGGTCACAT TGTGAAAATT-3¢ (antisense) for the exon 8–intron boundary; and 5¢-ACTGCCAGGCACCTTGCGTATTT-3¢ ... 5¢-GC-TCTTGTATTCCTGTAGGC CAG-3¢ (antisense) for exon 7; 5¢-GTATTCATCAGCAG CAGCC-3¢ (antisense) for exon 8; and 5¢-CTGTCTATCA TAGTCTCCAACCAT-CTTC-3¢ (antisense) for exon PCR was carried out at 53...

Ngày tải lên: 18/02/2014, 18:20

12 613 0
w