csar at texas tech university

Opinion of the Scientific Panel on food additives, flavourings, processing aids and materials in contact with food (AFC) pptx

Opinion of the Scientific Panel on food additives, flavourings, processing aids and materials in contact with food (AFC) pptx

... was estimated based on the conservative hypothesis that the concentration in the edible part of meat is identical to the concentration in the carcass Table 2: Consumption of meat and meat products ... peroxidation of unsaturated fatty acids (Esterbauer et al., 1991) The results provided show that peroxyacetic acid treatment, monitored as TBARS, had no detectable effect on the oxidation status ... heavily contaminated (SCVPH, 2003) It must be emphasised that, in general, decontamination treatments are able to reduce the contamination level but not completely eliminate pathogens Their effectiveness...

Ngày tải lên: 17/03/2014, 10:20

27 530 0
Báo cáo hóa học: " Research Article A Simplified Constant Modulus Algorithm for Blind Recovery of MIMO QAM and PSK Signals: A Criterion with Convergence Analysis" ppt

Báo cáo hóa học: " Research Article A Simplified Constant Modulus Algorithm for Blind Recovery of MIMO QAM and PSK Signals: A Criterion with Convergence Analysis" ppt

... M) global system matrix, and b(n) is the filtered noise at the receiver output The purpose of blind source separation is to find the matrix W such that z(n) = a(n) is an estimate of the source ... Please note that in blind signals separation, the best that can be done is to determine W up to a permutation and scalar multiple [3] In other words, W is said to be a separation matrix if and ... This solution shows that the minimization of J(g1 ) forces the equalizer output to form a constellation that corresponds to the source constellation with a modulo π/2 phase rotation From (22), (23),...

Ngày tải lên: 22/06/2014, 06:20

13 444 0
báo cáo khoa học: "Down-regulation of TM4SF is associated with the metastatic potential of gastric carcinoma TM4SF members in gastric carcinoma" ppt

báo cáo khoa học: "Down-regulation of TM4SF is associated with the metastatic potential of gastric carcinoma TM4SF members in gastric carcinoma" ppt

... metastatic status revealed that only M0 patient (9%) and all M1 patients were CD63 negative With respect to pTNM stage, only stage I and II patients (22.2%) and no stage III patients were CD63 negative ... gender, tumor status, differentiation, pTNM stage and Lauren classification Contrary, CD9 protein level was associated with lymph node status (p = 0.03) as well as with metastatic status (p = 0.013); ... female patients (65%) were CD63 negative Furthermore, only one (25%) patients with N0 and (27.3%) patients with N1 demonstrated negative gene expression compared with (69.2%) of N2-3 stage patients...

Ngày tải lên: 09/08/2014, 01:24

8 369 0
Báo cáo y học: " Biliary peritonitis caused by a leaking T-tube fistula disconnected at the point of contact with the anterior abdominal wall: a case report" docx

Báo cáo y học: " Biliary peritonitis caused by a leaking T-tube fistula disconnected at the point of contact with the anterior abdominal wall: a case report" docx

... opening Intraoperative laparoscopic photograph illustrating opening to T-tube fistula tract (arrow) with diagrammatic representation of relation to biliary anatomy (b) Diagram of fistula pathway and ... visualisation of retained CBD stones (T-tube cholangiogram) Figure Cannulation of T-tube fistula Cannulation of T-tube fistula Intraoperative laparoscopic photograph illustrating cannulation of ... evidence that polyvinyl chloride (PVC) or hypoallergenic latex T-tubes (such as those coated with silicon) increase rates of biliary peritonitis compared to red rubber or normal latex T-tubes,...

Ngày tải lên: 11/08/2014, 21:22

4 439 0
Báo cáo y học: "Risk stratification of early admission to the intensive care unit of patients with no major criteria of severe community-acquired pneumonia: development of an international prediction rule" potx

Báo cáo y học: "Risk stratification of early admission to the intensive care unit of patients with no major criteria of severe community-acquired pneumonia: development of an international prediction rule" potx

... performed using Stata version 8.0 (Stata Corporation, College Station, TX, USA) whereas about 20% (53) of the deaths occurred within three days of presentation Factors associated with ICU admission ... and outcomes stratification according to the risk of early ICU admission index (REA-ICU index) of patients with community acquired pneumonia Derivation population Validation population N ICU ≤ ... respiratory failure requiring mechanical ventilation or death) Most of these prediction rules were derived in populations including patients presenting with an obvious reason for immediate ICU...

Ngày tải lên: 13/08/2014, 16:20

11 471 0
Báo cáo y học: " Prognostic value of cell-free plasma DNA in patients with cardiac arrest outside the hospital: an observational cohort study" pdf

Báo cáo y học: " Prognostic value of cell-free plasma DNA in patients with cardiac arrest outside the hospital: an observational cohort study" pdf

... initial lactate concentration on arrival at the ED to six hours afterwards divided by initial lactate concentration value and multiplied by 100 Univariate comparisons of continuous data were performed ... concentration did not correlate with urea concentration (r = 0.26, P = 0.053), nor was it in correlation with age, leukocyte count, troponin, creatinine or glucose Plasma DNA concentrations at admission ... have found that cell-free plasma DNA concentration at inclusion correlated significantly with initial lactate concentrations and maximum lactate concentrations within a 24-hour period, which may...

Ngày tải lên: 13/08/2014, 20:21

11 530 0
Tài liệu Community Approaches to Child Health in Malawi: Applying the Community Integrated Management of Childhood Illness (C-IMCI) Framework docx

Tài liệu Community Approaches to Child Health in Malawi: Applying the Community Integrated Management of Childhood Illness (C-IMCI) Framework docx

... are contexts for its implementation Nonetheless, processes that promote meaningful community engagement and behavior change communication strategies that achieve saturation coverage of households ... be retreated with insecticide to continue to repel mosquitoes Retreat your net at least once a year Participate in retreatment activities in your community 7) Pneumonia is a disease that causes ... Care Groups Further, 75 percent stated that they had participated in trainings that promoters carry out with Care Group volunteers Sixty percent of HSAs stated that they conducted home visits with...

Ngày tải lên: 12/02/2014, 12:20

33 556 0
Tài liệu Occupational Pulmonary Tuberculosis among BRAC Community Health Workers of Trishal, Bangladesh docx

Tài liệu Occupational Pulmonary Tuberculosis among BRAC Community Health Workers of Trishal, Bangladesh docx

... UK, BRAC USA, Oxford University, Karolinska University, International Union for Conservation of Nature and Natural Resources (IUCN), Emory University, Agricultural Innovation in Dryland Africa ... was defined as a TB patient Quantitative data were analyzed by SPSS software, while the qualitative data were handled manually The estimated prevalence rate of smear-negative PTB among the shasthya ... in the general population of Bangladesh This implies that the grassroots health workers are at a greater risk of PTB Qualitative explorations revealed that contact with PTB patients and poverty...

Ngày tải lên: 15/02/2014, 13:20

39 336 0
Tài liệu The King''''s Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time pdf

Tài liệu The King''''s Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time pdf

... That at parting from them he went over the way to Mr Freeling's house." It is further stated that Mr Freeling was father to the late Sir F Freeling As regards Freeling's birthplace, information ... postmaster of Bath, to a position of great affluence, and of friendship with many of the great men of his time Among those friends was Lord Chatham It was twenty years after Allen's death that Palmer's ... the date of Allen's death: Allen may have been a Freemason [By permission of Mr Sydenham, of Bath TOKENS COMMEMORATIVE OF PALMER'S MAIL COACH SYSTEM [Pg 51] It is to Mr Sydenham, of Bath, that...

Ngày tải lên: 17/02/2014, 02:20

158 674 0
Tài liệu Báo cáo khoa học: Structure of RNase Sa2 complexes with mononucleotides – new aspects of catalytic reaction and substrate recognition pptx

Tài liệu Báo cáo khoa học: Structure of RNase Sa2 complexes with mononucleotides – new aspects of catalytic reaction and substrate recognition pptx

... phosphorus atom, causing electron deficiency on the phosphorus atom and, consequently, enhancing formation of the cyclophosphate intermediate Negatively charged Glu56 can interact with the hydrogen atom ... favorable conformation and distance allow Glu56 to interact with the hydrogen atom bonded to O2¢, weakening its attachment to the oxygen and facilitating O2¢ attack on the phosphorus atom In both ... 2¢,3¢-cyclophosphate is produced as an intermediate product In the second step, hydrolysis, the cyclic intermediate is hydrolyzed in the presence of a water molecule, yielding an RNA strand that terminates...

Ngày tải lên: 18/02/2014, 11:20

13 523 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

... as a heme-binding site [26], suggesting that HO-2 may sequester heme to maintain the intracellular heme concentrations or ameliorate heme-mediated oxidative stress Moreover, unlike the severe ... These results indicate that the down-regulation of HO-2 expression is associated with induction of HO-1 expression FEBS Journal 273 (2006) 5333–5346 ª 2006 The Authors Journal compilation ª 2006 FEBS ... cells treated with hemin (Fig 9B) Thus, heme may be more efficiently incorporated into HeLa cells than HepG2 cells or the incorporated heme may exceed the capacity of heme degradation mediated by...

Ngày tải lên: 19/02/2014, 05:20

14 488 0
Tài liệu Báo cáo khoa học: AcmA of Lactococcus lactis is an N-acetylglucosaminidase with an optimal number of LysM domains for proper functioning ppt

Tài liệu Báo cáo khoa học: AcmA of Lactococcus lactis is an N-acetylglucosaminidase with an optimal number of LysM domains for proper functioning ppt

... CGCGAATTCAGATTATGAAACAATAAG CGCGAATTCTTATGTCAGTACAAGTTTTTG CGCGAATTCCTTATGAAGAAGCTCCGTC CTTCAACAGACAAGTCC AGCAATACTAGTTTTATA CGCGAATTCGCTAGCGTCGCTCAAATTCAAAGTGCG AGGAGATCTGCGACTAACTCATCAGAGG GCATGAATTCATCGCGAACTGCTATTGGTTCCAG ... AGGAGATCTGCGACTAACTCATCAGAGG GCATGAATTCATCGCGAACTGCTATTGGTTCCAG GGTACTGCCGGGCCTCCTGCGG ACAACTGTTAAGGTTAAATCCGGAGATACCCTTTGGGCG TCAATTCATAAGGTCGTTAAAGGAGATACTCTCTGG AGCGGAATTCAATAATTTATTTTATTCGTAGATACTGACC EcoRI ... derivatives with 1.5 and repeats These data indicate that removal of the repeats does not destroy AcmA activity on M lysodeicticus cell walls in vitro Autolysis To analyze the effect of the repeats...

Ngày tải lên: 19/02/2014, 18:20

15 460 0
Tài liệu Painting with print: Incorporating concepts of typographic and layout design into the text of legal writing documents docx

Tài liệu Painting with print: Incorporating concepts of typographic and layout design into the text of legal writing documents docx

... Visiting Fellow, Natl Ctr for State Courts, Presentation, Jury Trends and Innovations, in Report on Proceedings of The Second Western Regional Conference on State-Federal Judicial Relationships Jury ... presentation matters.15 Similarly, the National Law Enforcement Trainers Association has published short articles about the use of good typography in presentations.16 Moreover, the United States ... those attorneys responsible for updating the state UCC provisions should advise against the common usage of all capitals to satisfy the requirement in Section 2-316 that the exclusion or modification...

Ngày tải lên: 21/02/2014, 05:20

45 646 0
Tài liệu COMMUNITY-BASED MANAGEMENT OF SEVERE ACUTE MALNUTRITION doc

Tài liệu COMMUNITY-BASED MANAGEMENT OF SEVERE ACUTE MALNUTRITION doc

... initiatives, including promotion of breastfeeding and appropriate complementary feeding, and provision of relevant information, education and communication (IEC) materials • Activities related ... deaths every year Using existing studies of case fatality rates in several countries, WHO has extrapolated mortality rates of children suffering from severe acute malnutrition The mortality rates ... 10,000/g maximum negative in g negative in g maximum 10 in g maximum 50 in g negative in g negative in 125 g negative in 25 g The product should comply with the Recommended International Code of...

Ngày tải lên: 21/02/2014, 21:20

8 447 0
Tài liệu Improving Fourth Grade Students’ Writing Skills With 6+1 Traits of Writing and Writer’s Workshop ppt

Tài liệu Improving Fourth Grade Students’ Writing Skills With 6+1 Traits of Writing and Writer’s Workshop ppt

... -Continued writing the results of data analysis -Created graphs to show project results -Updated references to include intervention materials -Created cover and signature pages -Revised all sections ... congratulations Let’s just listen to and absorb what the writers in this group are doing Watch the face of each writer as we go around the circle and listen to what he or she tells (pp 143-144) Atwell ... Literature Review August -Continued research for the Literature Review -Began Situating the Problem -Began writing Literature Review -Researched lesson ideas September -Changed focus of the Literature...

Ngày tải lên: 24/02/2014, 18:20

41 640 0
Báo cáo khoa học: Interactions of imidazoline ligands with the active site of purified monoamine oxidase A potx

Báo cáo khoa học: Interactions of imidazoline ligands with the active site of purified monoamine oxidase A potx

... kynuramine oxidation by agmatine (50% inhibition at mm in the presence of 0.3 mm kynuramine) and its very slow reduction of anaerobic MAO-A indicate that MAO-A is not a pathway for agmatine metabolism ... oxidation of this biologically active amine [35] Inhibition of MAO-A by I2BS ligands is shown here to require over 1000-fold higher concentrations than that reported in the literature for saturation ... to act as a substrate (mean dis˚ tance in the three best orientations was A) All the three possible forms of agmatine were docked into MAO-A: neutral, protonated, and diprotonated Although the...

Ngày tải lên: 07/03/2014, 10:20

9 473 0
Báo cáo khoa học: DNA polymerase e associates with the elongating form of RNA polymerase II and nascent transcripts pot

Báo cáo khoa học: DNA polymerase e associates with the elongating form of RNA polymerase II and nascent transcripts pot

... 10 at room temperature Samples to be stained with H3 antibody at a later stage were treated with m HCl for at room temperature to denature the DNA Prior to antibody treatment, cells were treated ... differences in the localization pattern of the two proteins at the different time points investigated, indicating that colocalization is not limited to a specific cell cycle stage We repeated immunoelectron ... phosphorylated at Ser5, and 8WG16 antibody recognizes RNA pol II that is not phosphorylated at DNA polymerase e associates with RNA polymerase II Ser2, but may or may not have phosphate at Ser5...

Ngày tải lên: 07/03/2014, 11:20

15 584 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

... 87SufI-BamHI-rv (5¢-ACGCGGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site ... that follow disparate targeting/translocation pathways In conclusion, the data suggest that TF, although interacting with Tat signal peptides, does not play a critical role in the export of Tat-dependent ... inhibits SecBmediated transport [3] whereas Tat-mediated transport proceeds unaffected (Fig 5) The latter observation is not unexpected because TF only associates with Tat substrates during synthesis...

Ngày tải lên: 07/03/2014, 16:20

9 393 0
Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf

Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf

... consisting of 10 lg creatine kinase and 7.5 mM creatine phosphate The assay was initiated by adding mM MgCl2 and mM GTP as substrate and incubated at 37 °C for 5–10 The reaction was terminated by addition ... manganesemediated activation of GC-C, mM manganese and mM GTP was used as substrate In experiments performed to monitor Lubrol-PX mediated activation, membranes were incubated in 0.3% Lubrol-PX for 10 at ... GC-C without glycosylation, indicating that the two forms of GC-C represented alternately glycosylated forms of the receptor (Fig 3A) EndoH treatment of the immunoprecipitate led to a reduction...

Ngày tải lên: 08/03/2014, 08:20

10 427 0
w