cs ca blend hollow fiber membranes

... Wavelength windows in silica based optical fiber (taken from David R Goff 2002) Figure 1-1 shows the wavelength windows of fiber attenuation for commercial silica based optical fiber The Figure shows ... fiber, and (4) a photoreceiver for conversion of optical to electrical signals (Agrawal 1997) In such systems, source modulation rate, optical fiber length and type, need for optical amplification, ... commercial fiber- optic communication systems came through concurrent development of low attenuation optical fiber and compact GaAs semiconductor lasers In 1978, the first generation fiber- optic...

Ngày tải lên: 14/09/2015, 08:50

... measurement An infrared camera (ThermaCAM from FLIR Systems) was used to capture the thermal images on the building surface for every minutes for 12 hours (9:00am - 9:00pm) The camera had the following ... selection, which is not only for their esthetical aspect but also on the local climate and energy consumption of buildings (a) (b) (c) (d) Figure The selected facade buildings in Johor Bahru, Malaysia; ... exterior wall surface temperature varied during midday because of the heat capacity of brick wall In general, temperature differences are caused by different thermal inertia [7] The brick showed...

Ngày tải lên: 05/09/2013, 15:28

... Journal Chemical and Mechanical Engineering Currently, Dr Abid is Professor of Mechanical Engineering at National School of Engineers of Sfax He is a head of the Laboratory of Electromechanical Systems ... Bachelor degree in chemical engineering in 1981, his Doctor-engineer in 1984 and his PhD in chemical engineering in 1988 He is interested in Computational Fluid Dynamics CFD and energy He is ... conclusions we can draw from this paper are the following: 1- The analysis of the flow and mixture motion features, during the intake stroke, is numerically made by a CFD code The numerical study...

Ngày tải lên: 05/09/2013, 16:30

Ngày tải lên: 16/12/2013, 08:15

... vegetation Most of the parameters are measured, or can be readily calculated from weather data The equation can be utilized for the direct calculation of any crop evapotranspiration as the surface ... on globe land classification at 30 s resolution [13] Fig 2.b shows the vegetation classification at 30 s resolution for the Nong Son catchment In this area, there are ten categories of land cover ... monthly meteorological data at the Tra Table Monthly average meteorological characteristics in the Nong Son catchment Characteristics T (oC) RH (%) n (hours/day) u (m/s) Jan 20.6 89.4 3.5 0.8 Feb 21.9...

Ngày tải lên: 05/03/2014, 16:20

... standard western-type diet (17.3% protein, 48.5% carbohydrate, 21.2% fat, 0.2% cholesterol, 4.5 kcalÆg)1) for 24 weeks, and histological and biochemical analyses were performed We found that deficiency ... 0.05) There was no statistically significant difference between the two groups (P > 0.05) Although, in this study (n = 5), we were unable to determine a statistically significant difference in the ... of the carboxy-terminal domain of ApoE can account for the dyslipidemia that is associated with the E2 ⁄ E2 phenotype Biochemistry 42, 9841–9853 Lewis GF, Carpentier A, Adeli K & Giacca A (2002)...

Ngày tải lên: 05/03/2014, 23:20

... AREA by Lorenzo Cappiello 2, Arjan Kadareja 3, Christoffer Kok Sørensen and Marco Protopapa In 2010 all ECB publications feature a motif taken from the €500 banknote This paper can be downloaded ... 6000 All rights reserved Any reproduction, publication and reprint in the form of a different publication, whether printed or produced electronically, in whole or in part, is permitted only with ... applied on loans to enterprises, have signi…cant e¤ects on real economic activity In other words, a change in loan growth has a positive and statistically signi…cant e¤ect on GDP This highlights the...

Ngày tải lên: 15/03/2014, 10:20

... decapitation Blood (with EDTA as anticoagulant) and other tissues, including brain, heart, aorta, and kidney, were collected for serum HBV replications or other biomedical parameters as indicated ... 15.0 statistical software Student’s unpaired t-test or ANOVA were used to determine 2612 the statistical significance of different groups A P-value < 0.05 was considered to be significant Acknowledgements ... inhibit HBV replication, as shown in Fig 6, we conclude that BetA could be a good candidate for anti-HBV drug development 2608 BetA-mediated CREB dephosphorylation As BetA could cause CREB dephosphorylation...

Ngày tải lên: 16/03/2014, 01:20

... aesthetics Those sets of drawings for which the effect of the aesthetics were significant were then subject to a ~hkey's pairwise comparison [9] to determine which aesthetics differed significantly ... determine if there were significant understandability priorities between the aesthetics Experiments were run online to study these five aesthetics, and the results indicate that crosses is by far ... the ten graph drawings, and their associated metric values Note that because of the nature of the aesthetics, the metrics cannot be sensibly compared over the aesthetic dimension Thus, while c-...

Ngày tải lên: 16/03/2014, 18:20

... 4impromptu changes in musical style Many critics say the only song writers that can be compared to Dylan are the team of Paul McCartney and John Lennon John Lennon began his musical career in high school, ... began his musical career in high school, with he band called the Quarryman In his sophomore year he met Paul McCarntey A short time later, McCartney introduced Lennon to his friend, George Harrison, ... most important musical events of this century, The British Invasion of America The British Invasion was a movement of British music and musicians across the Atlantic to America Bands such as Led...

Ngày tải lên: 21/03/2014, 22:03

... include many violent aspects The violence in these video games can desensitize children to violence and alter their perception of reality It can give them the idea that violence is the way to deal with ... of how video games affect children because the technology is so new It has been assumed that studies dealing with other forms of media will also apply here (McAfee) In the first few year of a child's ... as they spend in school, for a full twelve years (Entertainment Monitor, 1995) As a teenager I can personally attest to the fact that most parents don't know what their children are listening...

Ngày tải lên: 21/03/2014, 22:52

... include many violent aspects The violence in these video games can desensitize children to violence and alter their perception of reality It can give them the idea that violence is the way to deal with ... of how video games affect children because the technology is so new It has been assumed that studies dealing with other forms of media will also apply here (McAfee) In the first few year of a child's ... are left to make up their own minds about things Next time you wonder about how easily children can be convinced of something think of the myth of Santa Claus: One man bringing presents to the...

Ngày tải lên: 21/03/2014, 22:52

... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTGATGTGGTTCATC-3¢ (PstI-HindIII) ... Pfg27A: 5¢-AAA CTGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAA AAGCTTAATATTGTTGTGATGTGGTTCATC-3¢ (PstIHindIII); Pfg27B: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTG TGATGTGGTTCATC-3¢ (PstI); ... 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI);...

Ngày tải lên: 23/03/2014, 21:20

... for Celtics tickets, Red Sox tickets, and Banners, by payment method Celtics Cash mean (N ˆ 31) (std err) Credit card mean (N ˆ 33) (std err) Credit card premium t-test Cash median Credit card median ... certi®cate of a stated value This allows us to evaluate whether the credit card premium arises because customers adjust their valuations from different anchoring points in the cash and credit card ... conditions For example, in the cash condition respondents may anchor their valuations using the amount of cash that they typically carry in their wallets In the credit card condition they may anchor...

Ngày tải lên: 29/03/2014, 03:21

Ngày tải lên: 30/03/2014, 01:20

... VRK2A: 5¢CCCGGATCCATGCCACCAAAAAGAAATGAAAAAT ACAAACTTCC-3¢ (nucleotides 130–165), this primer has the initiation codon and a BamH1 cloning site VRK2X: 5¢GGGTCTAGAGGAATTTTGGTATCATCTTCAGAG-3¢ (nucleotides ... epitope was from Covance (San Francisco, CA) The polyclonal antibody specific for calreticulin was from Calbiochem (La Jolla, CA) and monoclonal anti(calnexin AF18) was from Santa Cruz p53 protein ... Therefore, the localization of endogenous VRK1 and VRK2 proteins was simultaneously determined by confocal microscopy in MCF7 cells from a breast adenocarcinoma, A549 cells from lung adenocarcinoma...

Ngày tải lên: 30/03/2014, 11:20

... (the (5¢-CCATGGCAACCAAACCCTCTGGTCCTA-3¢ NcoI restriction site is underlined) and one reverse primer (5¢-AAGCTTAGATACTTCTTGACTTTCACC-3¢) (HindIII) Hence, the TGA stop codon which is located at ... Silicatein alpha: cathepsin 1-like protein in sponge biosilica Proc Natl Acad Sci USA 95, 6234–6238 Cha JN, Shimizu K, Zhou Y, Christianssen SC, Chmelka BF, Stucky GD & Morse DE (1999) Silicatein ... It must be stressed that the silica formation in diatoms proceeds nonenzymatically, in contrast with sponges which form the spicules enzymatically using silicatein However, up until now, nobody...

Ngày tải lên: 30/03/2014, 20:20

... leukodopachrome (see Fig 6), dopaquinone can also oxidize 5-S-cysteinyldopa, the precursor of pheomelanins [35] 4-t-Butyl catechol, 4-methyl catechol, and catechol have been shown to have synergistic ... agents J Agric Food Chem 48, 1393–1399 Cabanes, J., Garcia-Canovas, F., Tudela, J., Lozano, J.A & Garcia-Carmona, F (1987) L-Mimosine, a slow-binding inhibitor of catecholase activity of tyrosinase ... decarboxylation of 3,4-dihydroxymandelic acid: identification of 3,4-mandeloquinone as a key intermediate Biochim Biophys Acta 998, 57–62 31 Cabanes, J., Sanchez-Ferrer, A., Bru, R & Garcia-Carmona,...

Ngày tải lên: 31/03/2014, 09:20

... Intervals of trading days(a) Mean (%) Z-statistic %Positive AR -1 AR AR +1 CAR -10, -1 CAR -1, CAR -1, +1 CAR 0, +3 CAR 0, +5 CAR -10, +10 0.16 0.06 0.03 0.08 0.21 0.25 0.06 0.28 0.30 0.237 0.885 ... (%) Z-statistic %Positive Mean (%) Z-statistic %Positive AR -1 AR AR +1 CAR -10, -1 CAR -1, CAR -1, +1 CAR 0, +3 CAR 0, +5 CAR -10, +10 0.16 0.18 -0.14 0.16 0.33 0.19 -0.06 0.25 0.36 0.274 -0.417 ... (%) Z-statistic %Positive Mean (%) Z-statistic %Positive AR -1 AR AR +1 CAR -10, -1 CAR -1, CAR -1, +1 CAR 0, +3 CAR 0, +5 CAR -10, +10 0.25 0.10 -0.03 0.30 0.35 0.32 -0.11 -0.24 0.52 -0.908 -0.061...

Ngày tải lên: 01/06/2014, 13:58

... as allograft bone, ceramics, and biologics including recombinant human bone morphogenetic proteins (rhBMPs) Recent clinical trials have demonstrated excellent biological potency of rhBMPs that ... quantities of cancellous bone graft with reduced morbidity but cannot be used for corticocancellous graft harvest and not result in sufficient quantity of graft for most spinal applications [20,21] ... wound under direct visualization, and cortical and cancellous bone graft strips were harvested No patients had indwelling local anesthetic infusion catheters and no patients had bone graft harvest...

Ngày tải lên: 18/06/2014, 18:20