crossword puzzle for biological basis of genetics 1

Tài liệu English for students of Physics_Unit 1 doc

Tài liệu English for students of Physics_Unit 1 doc

... nm mxnx x + + = 21 6. () 1 12 12 1 xx xx yy yy − ⎟ ⎟ ⎠ ⎞ ⎜ ⎜ ⎝ ⎛ − − =− 7. 1 2 2 2 2 2 2 =++ c z b y a x 8. ()()() [ ] 2 21 2 21 2 21 zzyyxxd −+−+−= 9. ( ) 222 1 eab −= 10 . 022 22 =++++ ... president in 17 97. In 18 31 the British Association for the Advancement of Science met for the first time, followed in 18 48 by the American Association for the Advancement of Science, and in 18 72 by ... Geography 8. History 9. Information Science 10 . Linguistics 11 . Mathematics 12 . Meteorology 13 . Physics 14 . Political Science 15 . Psychology is a branch of science which/that Section...

Ngày tải lên: 25/01/2014, 23:20

15 688 1
Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf

Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf

... Commun Mass Spectrom 14 , 2080–20 81, doi: 10 .10 02 /10 97-02 31( 200 011 15 )14 : 21& lt;2080::AID-RCM120>3.0.CO;2-P [pii]. 27 Kerr JF, Wyllie AH & Currie AR (19 72) Apoptosis: a basic biological phenomenon ... Department of Biochemistry, Biosciences Institute, University College Cork, Ireland (Received 16 February 2 010 , revised 19 March 2 010 , accepted 23 March 2 010 ) doi :10 .11 11/ j .17 42-4658.2 010 .076 61. x Activation ... b- CH 3 SOH 11 y- CH 3 SOH Myr-Gly Asn Gly OxM 6 5 4 3 2 1 b ions 268.23 382.27 439.29 586.33 700.37 522.33 636.37 y ions 579.26 465. 21 408 .19 2 61. 16 14 7. 515 .26 4 01. 21 344 .19 1 2 3 4 5 6 Fig. 1. ...

Ngày tải lên: 16/02/2014, 14:20

11 580 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

... 2004) Eur. J. Biochem. 2 71, 2873–2886 (2004) Ó FEBS 2004 doi :10 .11 11/ j .14 32 -10 33.2004.0 419 8.x protein, the g rid was centered at three possible binding sites, with a 11 0 · 11 0 · 11 0 A ˚ cubic area to ... docked energy (kcalÆmole )1 ) Number of conformations in the cluster CC¢ sheet Top cavity 1 )15 .7 1 2 )15 .5 5 Top Cavity Top cavity 1 )15 .2 2 2 )13 .2 1 Bottom cavity Top cavity 1 )15 .5 1 2 )14 .9 2 Table 3. ... position of the peptide after docking Cluster Rank Lowest docked energy (kcalÆmole )1 ) Number of conformations in the cluster CC¢ sheet CC¢ sheet 1 )10 .7 2 2 )10 .0 5 Top cavity CC¢ sheet 1 )10 .4 1 2...

Ngày tải lên: 19/02/2014, 13:20

14 658 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... (2005) A novel role for Vpr of human immunodeficiency virus type 1 as a regulator of the splicing of cellular pre- mRNA. Microbes Infect 7, 11 50 11 60. 35 Zhang X & Aida Y (2009) HIV -1 Vpr: a novel ... Wong-Staal F (19 91) Kinetics of expres- sion of multiply spliced RNA in early human immuno- deficiency virus type 1 infection of lymphocytes and monocytes. Proc Natl Acad Sci USA 88, 5 011 –5 015 . 13 O’Reilly ... References A2 ESSV hnRNP A1 U UAGGACAUAUAGUUAGCCCUAGG 4995–5 017 [5, 12 , 38, 40] ESE1 ASF ⁄ SF2 unknown A3 ESSp hnRNP H UGGGU 5362–5366 [48, 41, 15 , 17 , 8] ESS2 hnRNP A1 C UAGACUAGA 5428–5437 ESE2...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... 50 10 0 15 0 1/ [cyt c] (µM) -1 B y = 13 5 ,11 x + 24,829 0 10 20 30 40 50 60 -0,3 -0,2 -0 ,1 0 0 ,1 0,2 0,3 1/ [L-gulono -1, 4-lactone] (mM -1 ) 1/ V 0 1/ V 0 A Fig. 3. Characterization of the ... Institute of Brussels, 642 Engeland Street, B -11 80 Brussels, Belgium Fax: +32 2 373 3282 Tel: +32 2 373 310 0 E-mail: bwolucka@pasteur.be (Received 21 June 2006, accepted 31 July 2006) doi :10 .11 11/ j .17 42-4658.2006.05443.x The ... its selectivity for l-gulono -1, 4-lactone. Our preparations of the recombinant dehydrogenase of M. tuberculosis y = 0 ,13 71x + 28,762 0 5 10 15 20 25 30 35 40 4 5 -300 -250 -200 -15 0 -10 0 -50 0 50 10 0...

Ngày tải lên: 07/03/2014, 12:20

11 571 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

... K i , NK-1m (n M )EC 50 , phospholipase C SP (1) a 1. 6 ± 0.4 8 ± 2 0 .13 ± 0.02 1. 0 ± 0.2 Propionyl[Met(O 2 ) 11 ]SP(7 11 ) a 19 00 ± 450 >5000 10 ± 2 37 ± 4 [Pro9]SP (2) a 1. 1 ± 0 .1 10 ± 2 0 .13 ± ... n M ,65CiÆmmol )1 ) for 10 0 min or [ 3 H]propionyl[Met(O 2 )11 ]SP(7 11 ) (2–5 n M ,95 CiÆ mmol )1 ) for 80 min on whole CHO cells expressing the human NK -1 receptor (6 pmolÆmg protein )1 ) as described previously ... than SP. Table 1. Affinities of b-amino acid-containing peptide analogues of SP for the NK-1M (labelled with [ 3 H][Pro9]SP) and the NK-1m (labelled with [ 3 H]propionyl[Met(O 2 )11 ]SP(7 11 )) binding...

Ngày tải lên: 08/03/2014, 08:20

11 861 0
Báo cáo khoa học: Molecular basis of the unusual catalytic preference for GDP/GTP in Entamoeba histolytica 3-phosphoglycerate kinase doc

Báo cáo khoa học: Molecular basis of the unusual catalytic preference for GDP/GTP in Entamoeba histolytica 3-phosphoglycerate kinase doc

... protein )1 ) GDP 0.07 ± 0.03 41 ± 18 0.37 ± 0 .15 38 ± 2 ADP 7.4 ± 3.9 5.5 ± 0.8 0.5 ± 0 .17 53 ± 15 GTP 0. 016 ± 0. 01 4.5 ± 0.6 0.06 ± 0. 01 4.0 ± 0.3 ATP 5.0 ± 1. 7 1. 6 ± 0.06 0.42 ± 0.2 10 ± 1 Entamoeba GDP ... 90, 11 0 11 4. 14 Reeves RE & South DJ (19 74) Phosphoglycerate kinase (GTP). An enzyme from Entamoeba histolytica selective for guanine nucleotides. Biochem Biophys Res Commun 58, 10 53 10 57. 15 ... inhibitors (adenylyl 1, 1,5,5,-tetrafluor- opentane -1, 5-bisphosphonate), have been identified in the crystal structures of yeast [15 ,18 ], horse [29,30], pig [16 ,17 , 31] , B. stearothermophilus [19 ], T. brucei...

Ngày tải lên: 16/03/2014, 01:20

11 449 0
Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf

Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf

... D 2 O). (A) 1 H-NMR spectrum. (B) 1D- TOCSY of compound B H1 (80 ms). (C) 1D-TOCSY of compound B H2 (80 ms). (D) 13 C-HSQC spectrum (12 8 transients, 12 8 incre- ments, 1 J C,H = 14 0 Hz, 12 h). For selective ... kinetic parameters: K m = 14 .02 ± 6.05 lm; V max = 3.64 ± 1. 37 lmolÆmin )1 Æmg )1 ; k cat = 8.82 s )1 ; K i = 2.859 ± 1. 31 lm; k cat /K m = 6.3 · 10 5 m )1 Æs )1 . Structural characterization of His6-RMD from A. ... of GDP-d-perosamine. Glycobiology 11 , 655–6 61. 11 Bonin CP, Potter I, Vanzin GF & Reiter WD (19 97) The MUR1 gene of Arabidopsis thaliana encodes an isoform of GDP-d-mannose-4,6-dehydratase,...

Ngày tải lên: 16/03/2014, 01:20

15 402 0
Báo cáo khoa học: Molecular basis for specificities of reactivating factors for adenosylcobalamin-dependent diol and glycerol dehydratases pptx

Báo cáo khoa học: Molecular basis for specificities of reactivating factors for adenosylcobalamin-dependent diol and glycerol dehydratases pptx

... [ 51] from their deduced amino acid composition and subunit structure, were 12 0 500 m )1 Æcm )1 for diol dehydratase [35], 11 2 10 0 m )1 Æcm )1 for glycerol dehydratase [49], 58 14 0 m )1 Æcm )1 for DDR ... 700–8530, Japan Fax: + 81 86 2 518 264 Tel: + 81 86 2 518 194 E-mail: toraya@cc.okayama-u.ac.jp (Received 26 May 2007, revised 17 August 2007, accepted 29 August 2007) doi :10 .11 11/ j .17 42-4658.2007.06074.x Adenosylcobalamin-dependent ... pneumoniae NCIB 418 . J Bacteriol 15 1, 5 91 599. 11 Ruch FE, Lengeler J & Lin ECC (19 74) Regulation of glycerol catabolism in Klebsiella aerogenes. J Bacteriol 11 9, 50–56. 12 Seyfried M, Daniel...

Ngày tải lên: 16/03/2014, 05:20

11 434 0

Bạn có muốn tìm thêm với từ khóa:

w