A Designated Center of Academic
... of thread that calls it – The DLL uses the stack of the calling thread and the virtual address space of the calling process – The DLL allocates memory from the virtual address space of the calling ... Systems Programming 10 2/27/2008 Advantages of Using DLL Some advantages over static linking – Smaller program image – Save system memory, since multiple processes can share a single copy of the ... Last Class Memory Management – Overview – Heap management – Memory-mapped files – Dynamic link libraries CS222 - Systems Programming 2/27/2008 Today’s Class Memory Management – Overview...
Ngày tải lên: 12/09/2012, 14:38
... Rudolph Tanzi Creating a Transformative Culture of Learning The Big Hippocampus Amygdala Basal ganglia Creating a Transformative Culture of Learning Hippocampus The “data drive” Moves learning ... videos Avg 750 released per week Creating a Transformative Culture of Learning Agenda Learning Culture Transformative Learning Benefits/ROI Create a Culture of Transformation Creating a Transformative ... As a result, they may plateau early and achieve less than their As a result, they reach ever-higher levels of potential and full potential performance Creating a Transformative Culture of Learning...
Ngày tải lên: 30/11/2015, 00:51
... TopSecretWriters was dif f erent It wasn’t work It was less about making money, and more about having lof ty goals and ideas to share that I am passionate about It was my way of tossing my message in a bottle ... that was actually limiting at all in any way, since there weren’t the library of readymade tools available to “add-on” to the base platf orm Joshua didn’t hesitate to point out that the Vox platf ... Come…Eventually Was there a lot of up-f ront investment and loss required to get that early growth started? Can you share at what point that Smashing Magazine became prof itable, and what that f elt...
Ngày tải lên: 07/02/2014, 15:35
Tài liệu A Journey into the Center of the Earth doc
... costume consisted of a coarse jacket of black woollen cloth called in Scandinavian lands a ‘vadmel,' a hat with a very broad brim, trousers 50 with a narrow edge of red, and a bit of leather rolled ... Gräuben was there; so I said nothing, and could eat nothing At half-past five there was a rattle of wheels outside A large carriage was there to take us to the Altona railway station It was soon ... not a word, and for a very good reason My eyes had fallen upon a charming picture, suspended against the wall, the portrait of Gräuben My uncle's ward was at that time at Altona, staying with a...
Ngày tải lên: 17/02/2014, 04:20
Tài liệu Adding value to traditional products of regional origin - A guide to creating a quality consortium pptx
... al 2009) In Indonesia, for example, as part of a broad initiative whose ultimate aim was to register Kintamani Bali Arabika coffee as a geographical indication, organic certification was obtained ... whose aim is to add value to a traditional product of regional origin and act as a platform for the fair and balanced coordination of interests and efforts in the same value chain The reach of the ... use of the mark Trademark Office Trademark Office Registration Appropriate national Ministry Legal basis Protection based on an act Protection based on administrative registration of public law...
Ngày tải lên: 18/02/2014, 21:20
Báo cáo khoa học: "Creating a Corpus of Parse-Annotated Questions" docx
... al (2005) The research established that even a small amount of additional training data can give a substantial improvement in question analysis in terms of both CFG parse accuracy and LFG grammatical ... 498 Algorithm Induce a parse-annotated treebank from raw data repeat Parse a new section of raw data Manually correct errors in the parser output Add the corrected data to the training set Extract ... a new grammar for the parser until All the data has been processed were being produced at an average rate of 40 trees per day During the later stages of the project this had changed dramatically...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf
... was trained over a manually annotated corpus of approximately 208,000 words, and evaluated against an unseen portion with approximately 52,000 words It scored 86.53% precision and 84.94% recall ... corresponding values for its inflectional features of Gender and Number, that resulted from its morphological analysis; lemmata — the lemmata (singular and masculine forms when available) possibly ... inflection feature values, are displayed Now, any of these lemmas can also be clicked on, which will activate back the LX-Conjugator and will make the corresponding conjugation table to be displayed...
Ngày tải lên: 17/03/2014, 02:20
Báo cáo Y học: The human b-globin locus control region A center of attraction potx
... proteins and binds to DNA as a heterodimer usually composed of USF1 and USF2 USF has been implicated in the regulation of many genes and normally acts as a transcriptional activator However, it has also ... absence of chromatin assembly Mol Cell Biol 21, 2629–2640 86 Ogawa, K., Sun, J., Taketani, S., Nakajima, O., Nishitani, C., Sassa, S., Hayashi, N., Yamamoto, M., Shibahara, S., Fujita, H & Igarashi, ... Hohmura, K.I., Bungert, J., Hayashi, N., Nagasawa, T., Engel, J.D., Yamamoto, M., Takeyasu, K & Igarashi, K (1999) Long range interaction of cis-DNA elements mediated by architectural transcription...
Ngày tải lên: 18/03/2014, 01:20
A Journey into the Center of the Earth potx
... Gräuben was there; so I said nothing, and could eat nothing At half-past five there was a rattle of wheels outside A large carriage was there to take us to the Altona railway station It was soon ... combinations; he was far away from earth, and really far away from earthly wants About noon hunger began to stimulate me severely Martha had, without thinking any harm, cleared out the larder the night ... not a word, and for a very good reason My eyes had fallen upon a charming picture, suspended against the wall, the portrait of Gräuben My uncle's ward was at that time at Altona, staying with a...
Ngày tải lên: 23/03/2014, 00:20
A Collaborative Project of The Mickey Leland National Urban Air Toxics Research Center and The National Center for Health Statistics pot
... examination center NCHS National Center for Health Statistics NHANES National Health and Nutrition Examination Surveys NUATRC National Urban Air Toxics Research Center RFA Request for Applications ... are fees associated with using the Research Data Center The Research Data Center is located at the NCHS headquarters office in Hyattsville, Maryland Researchers may work onsite at the headquarters ... 10 NA NA NA NA NA NA 2.3 × 10− NA NA NA RfC b (μg m− 3) 30 NA 1000 NA NA NA 800 NA NA NA 3000 CAS=Chemical Abstracts Service, MW=molecular weight, MP=melting point, and BP=boiling point are all...
Ngày tải lên: 28/03/2014, 19:20
A Proposed International Accounting Standard Reporting Turnover and Tax by Location A proposal by Richard Murphy BSc FCA on behalf of the Association for Accountancy and Business Affairs pptx
... Murphy is a chartered accountant and an economics and accountancy graduate Aged 44, he was senior partner of a firm of chartered accountants for fifteen years until 2000 He has also, in parallel, ... public awareness of the workings, the social, political and the economic role of accountancy and business organisations AABA’s patron is the Rt Hon The Lord Paul of Marylebone AABA trustees are Professor ... standard shall be separately made in respect of that permanent place of business although it does not have a separate legal identity 12 Related party 12.1 Two or more parties are related parties...
Ngày tải lên: 29/03/2014, 14:20
Proposal for a COUNCIL DIRECTIVE on a common system of financial transaction tax and amending Directive 2008/7/EC pot
... multiannual financial framework (Reference amount) (6) Commitments =4+ N /A N /A N /A N /A N /A N /A N /A N /A Payments =5+ N /A N /A N /A N /A N /A N /A N /A N /A Heading of multiannual financial framework: " Administrative ... =1+ 1a +3 =2+ 2a Payments +3 TOTAL operational appropriations EN Commitments (4) N /A N /A N /A N /A N /A N /A N /A N /A Payments (5) N /A N /A N /A N /A N /A N /A N /A N /A Year N is the year in which implementation ... in that State, or it has a branch in that State, in respect of financial transactions carried out by that branch Chapter II Chargeability, taxable amount and rates Article Chargeability of FTT...
Ngày tải lên: 29/03/2014, 18:20
e-Parliament to e-Democracy Creating a Model for Effective Management of Public Content
... http://scholar.sun.ac.za democracy, can help parliaments to become more transparent, accessible, accountable and effective in promoting democracy e-Parliament enables automation of parliamentary information ... end of the spectrum, many parliaments lack a strategic plan, an adequate ICT infrastructure, basic tools for Members of Parliament and staff, systems for managing documents and trained ICT staff ... provide a critical analysis of e-parliament strategies in some countries’ parliaments Further, through an analysis of some of the countries’ parliaments that have e-parliament systems in place,...
Ngày tải lên: 10/05/2014, 16:26
Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx
... KSGGGTCGACGTCATCAATGA CGTTRTAC AARGAATTCATKGGGGCCCA RARRGACTGGC GTGACGAAGATTGCATTCT AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC TGGTGGGAATCCCACCTT GTATTGTTATGGAAGGTGATA TATATGATGATGTTGGTC ... GAACCGGGA ACGTCTAGAACAATACTGATC GGTCTC GTGCTCTAGAAGGTGATAGC CGAACCGGGA GCGCGGAATCACTTGTGAAG CAGTCGT GCCGGGATTCGGTGAGTGGT TTACATCAC TACATCGGCCTTTGAGTCGC ATGG CTTATTAACGCCTATATAAAC ACC KSGGGTCGACGTCATCAATGA ... (EACMV), East African cassava mosaic Cameroon virus (EACMCV), East African cassava mosaic Malawi virus (EACMMV), East African cassava mosaic Zanzibar virus (EACMZV) and South African cassava...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học: " A new definition of burnout syndrome based on Farber''''s proposal" pptx
... this profile may also be explained by a background of prior learning within an organization managed with bureaucratic rules and demands, with an organizational system that does not rec- Page of 17 ... speaks of the semiotic square as a canonical representation of a set of relations Quoting Greimas, Imbert [24] states that it is "the visual representation of the logical articulation of any ... information contained in each of the selected units was compared and a common conceptual denomination was assigned to the group of segments sharing the same clinical profile as a standard As a next...
Ngày tải lên: 20/06/2014, 00:20
báo cáo hóa học:" Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pot
... KSGGGTCGACGTCATCAATGA CGTTRTAC AARGAATTCATKGGGGCCCA RARRGACTGGC GTGACGAAGATTGCATTCT AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC TGGTGGGAATCCCACCTT GTATTGTTATGGAAGGTGATA TATATGATGATGTTGGTC ... GAACCGGGA ACGTCTAGAACAATACTGATC GGTCTC GTGCTCTAGAAGGTGATAGC CGAACCGGGA GCGCGGAATCACTTGTGAAG CAGTCGT GCCGGGATTCGGTGAGTGGT TTACATCAC TACATCGGCCTTTGAGTCGC ATGG CTTATTAACGCCTATATAAAC ACC KSGGGTCGACGTCATCAATGA ... (EACMV), East African cassava mosaic Cameroon virus (EACMCV), East African cassava mosaic Malawi virus (EACMMV), East African cassava mosaic Zanzibar virus (EACMZV) and South African cassava...
Ngày tải lên: 20/06/2014, 04:20
the monk and the riddle the art of creating a life while making a living randy komisar
... year will make that a bargain And I can quote comps.” “Lenny, you have an idea, a cofounder, and a business plan Nothing earthshaking or inherently valuable like an exclusive market or a key patent ... without a sound More endless highway A scattering of thatched houses on stilts An occasional open-air market We slow down for water buffalo pulling a caravan of carts and weave paths around lumbering ... senior management and report progress against plan I once sat on the board of a startup that had raised an initial round of funding from a wealthy Hollywood financier This was the kind of startup...
Ngày tải lên: 05/07/2014, 07:35
báo cáo khoa học: "Case report of rapidly progressive proliferative verrucous leukoplakia and a proposal for aetiology in mainland China" pps
... Editor-in-Chief of this journal Acknowledgements This research was supported by the grant from National Natural Science Foundation of China, 30872873 Author details State Key Laboratory of Oral Diseases, ... this article as: Ge et al.: Case report of rapidly progressive proliferative verrucous leukoplakia and a proposal for aetiology in mainland China World Journal of Surgical Oncology 2011 9:26 Authors’ ... bucca, and mandibular gum, and to simultaneously undergo tissue repair with skin grafting The wound healed well after surgery A histological examination revealed that the palatal carcinoma in situ...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo khoa học: "Radiotherapy quality assurance review in a multi-center randomized trial of limited-disease small cell lung cancer: the Japan Clinical Oncology Group (JCOG) trial 0202" pptx
... patterns of practice in Japan at the start of this trial After parameter compliance was assessed, overall RT compliance was determined as PPoverall, no DA or VU in any parameter; VUoverall, at least ... S, Kawahara M, Tamura , Noda K, Watanabe K, Yokoyama A, Sugiura T, Senba H, Ishikura S, Ikeda H, Ishizuka N, Saijo N: Standard thoracic radiotherapy with or without concurrent daily lowdose carboplatin ... consisted of ipsilateral hilum and bilateral mediastinal (pretracheal, paratracheal, tracheobroncheal, and subcarinal) lymph nodes Contralateral hilar lymph nodes were not included in the CTV The planning...
Ngày tải lên: 09/08/2014, 09:22
Báo cáo y học: "Factors affecting the outcome of surgically treated non-iatrogenic traumatic cervical esophageal perforation: 28 years experience at a single center" docx
... 10% of cases [3,4] Although traumatic esophageal perforation is rare, its management is a challenge for thoracic surgeons Penetrating esophageal trauma occurs primarily in the cervical esophagus ... died after drainage alone were treated in the early 1990 s The interval from perforation to initiation of treatment is a crucial determinant of outcome after esophageal perforation Although advances ... Prompt diagnosis and treatment of esophageal perforation is essential for a favorable outcome Delay in treatment after esophageal perforation has been found to be associated with higher rates of both...
Ngày tải lên: 10/08/2014, 09:22