creating a new scl source file

... @"Provider=Microsoft.Jet.OLEDB.4.0;Data Source= " + fileName + ";"; // Use ADOX to create the Access database ADOX.Catalog cat = new ADOX.Catalog( ); try { cat.Create(connectString); } finally { cat = null; } } Discussion ADO ... Access database " + fileName + " created.", "Create Access Database", MessageBoxButtons.OK, MessageBoxIcon.Information); } catch (System.Exception ex) { MessageBox.Show("Could not create database ... Open the dialog if (sfd.ShowDialog( ) == DialogResult.OK) { // Of OK selected, create the Access database String fileName = sfd.FileName; try { CreateAccessDatabase(fileName); MessageBox.Show("Microsoft...

Ngày tải lên: 24/12/2013, 05:15

... executes a DDL CREATE DATABASE statement to create a new database on a SQL Server You can programmatically drop the database by using the DROP DATABASE statement in a similar way To drop the database ... Oracle databases and other databases is similar to that shown for SQL Server although the DDL syntax for each database varies slightly because of differences in database server capabilities and ... statements generally require DBA permissions to execute Database Management Language (DML) Used to manipulate—select, insert, update, and delete—data in the database objects Database objects are...

Ngày tải lên: 21/01/2014, 11:20

... Preparation Flora of China Vol (Berberidaceae through Capparaceae) Science Press, Beijing, and Missouri Botanical Garden Press, St Louis [3] Vietnamese Pharmacopoeia, Medical Publishing House, Hanoi, ... 0.25 µm) The analytical condition were the same as described above with He as carrier gas, and interface temperature 260o C Components identification was carried out by comparing MS data with those ... phytochemical works have been recorded for the C longepetiolatum Costerm apud Phamh found in Vietnam As a part of the research on the essential oils of Medicinal and Aromatic plants of the Vietnam flora,...

Ngày tải lên: 12/02/2014, 17:20

... Logistics and Transportation Universite Laval Quebec, Canada 63 Urmanbetova, Aselia U.S Pulp and Paper Industry School of Economics at Georgia Institute of Technology Atlanta Georgia th 64 "Paper and ... chain listed above For example, if bamboo paper is cheaper and functions well in a variety of end products demand for bamboo paper motivates paper and pulp mills to purchase bamboo as a raw material ... relocation in later years was driven by the availability of raw materials in the South and the Pacific regions (see appendix C for graph) 41 By 1870, a sharp increase in demand for paper, as well...

Ngày tải lên: 18/03/2014, 02:20

... NaAc conc vs the “E Time” Figure 5: Comparison of CO2 profile of TAD supernatant and NaAc additions Table 2: TAD supernatant VFAs estimation based on “E Time” approach Estimated VFAs Analytical ... supernatant and NaAc addition Observed CO2 evolution rates were similar in both cases, and the TAD supernatant VFA estimations are shown in Table Estimations showed a substantial overestimation, ... BNR enhancement, as the sodium acetate addition cases A higher P/VFAs molar ratio, observed in TAD addition case, suggested there were other potential carbon substrate available for P release (Li,...

Ngày tải lên: 05/09/2013, 08:40

... dwelling times have to be calculated [3]-[6] As an example Fig shows a 5-level space-vector diagram, assuming that the capacitor-voltages of the submodules are equal and scaled to the value (From ... PWM-operation) Unlike the conventional VSI, a common central capacitive storage is abundant This advantage eases the protection of the converter against mechanical destruction in case of a short ... “submodules” was a prerequisite For the sake of stringent modular and scalable realization, additional “central” components have to be avoided The DC-link capacitor of conventional voltage source inverters...

Ngày tải lên: 15/10/2013, 16:23

... Costa AM, Martins MT, Kobayashi GS, Zucconi E, Fanganiello RD, Salles FT, Almeida AB, Amaral CE, Alonso N, Passos-Bueno MR: New Source of Muscle-Derived Stem Cells with Potential for Alveolar ... São Paulo, Brazil) Unconjugated markers were reacted with anti-mouse PE secondary antibody (Guava Technologies, Hayward, CA) Unstained cells were gated on forward scatter to eliminate particulate ... Célia Koiffmann and Cláudia I E de Castro for karyotype analysis and pictures; Marta Cánovas for technical support; Page of 10 (page number not for citation purposes) Journal of Translational...

Ngày tải lên: 18/06/2014, 15:20

... gene GAPDH Sense: GGACTCATGACCACAGTCCATGCC Antisense: TCAGGGATGACCTTGCCCACA Bone-specific genes ALP Sense: TGGAGCTTCAGAAGCTCAACACCA Antisense: ATCTCGTTGTCTGAGTACCAGTCC OC Sense: ATGAGAGCCCTCACACTCCTC ... ATGAGAGCCCTCACACTCCTC Antisense: GCCGTAGAAGCGCCGATAGGC Adipose-specific genes LPL Sense: GAGATTTCTCTGTATGGCACC Antisense: CTGCAAATGAGACACTTTCTC PPARγ Sense: TGAATGTGAAGCCCATTGAA Antisense: CTGCAGTAGCTGCACGTGTT Cartilage-specific ... Cartilage-specific genes AGN Sense: TGCGGGTCAACAGTGCCTATC Antisense: CACGATGCCTTTCACCACGAC COL 2A1 Sense: GGAAACTTTGCTGCCCAGATG Antisense: TCACCAGGTTCACCAGGATTGC AGN, aggrecan; ALP, alkaline phosphatase;...

Ngày tải lên: 09/08/2014, 10:23

Ngày tải lên: 04/10/2012, 10:24

Ngày tải lên: 04/10/2012, 10:24

... of data that could allow for a structured evaluation of the organizational changes It is evident that a well-planned evaluation of changes in the organizations, before they are actually made, ... on performance Acta Anaesthesiol Scand 2010, 54(6):689-695 Handbooks of the Ministry of Social Affairs and Health Ambulance and emergency care services: A handbook for drawing up an alarm procedure ... this article as: Lindström et al.: Implementation of a new emergency medical communication centre organization in Finland - an evaluation, with performance indicators Scandinavian Journal of Trauma,...

Ngày tải lên: 25/10/2012, 10:02

... of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors By the fact that the rare earth metals trapped inside of the carbon cage are ... Gd@C60[C(COOH)2]10 as a MRI contrast agent J Am Chem Soc 2003; 125: 5471-8 Okumura M, Mikawa M, Yokawa T, et al Evaluation of water-soluble metallofullerenes as MRI contrast agents Acad Radiol 2002; ... Then the organic phase was washed with water, followed by 1N-HCl and again water The organic layer was dried over Na2SO4 and evaporated The resulting residue was chromatographed on silicagel by elution...

Ngày tải lên: 26/10/2012, 09:07

... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia ... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the...

Ngày tải lên: 31/10/2012, 14:59

... 2001;413(6853):316-22 Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu R, Imaki H, Ishida N, Okumura F, Nakayama K, Nakayama KI Phosphorylation-dependent degradation of c-Myc is mediated by the F-box ... 2004;23(10):2116-25 Nateri AS, Riera-Sans L, Da Costa C, Behrens A The ubiquitin ligase SCFFbw7 antagonizes apoptotic JNK signaling Science 2004;303(5662):1374-8 Tsunematsu R, Nakayama K, Oike Y, Nishiyama M, ... endometrial carcinoma J Pathol 2003;201(4):589-95 Moberg KH, Bell DW, Wahrer DC, Haber DA, Hariharan IK Archipelago regulates Cyclin E levels in Drosophila and is mutated in human cancer cell lines Nature...

Ngày tải lên: 31/10/2012, 16:49

... However, Feynman soon learned that there was a great obstacle to this delayed action-at -a- distance theory: namely, if a radiating electron, say in an atom or an antenna, were not acted upon at all by ... contact transformations,” which has an important quantum mechanical analogue, namely, the transformation matrix (qt |qT ) This matrix connects a representation with the variables q diagonal at ... xn (a) and which leaves the action invariant (for example, the transformation may be a rotation) The transformation is to contain a parameter, a, and is to be a continuous function of a For a equal...

Ngày tải lên: 06/11/2012, 11:21

... not panicking I feel nothing but calmness No migraine pain In the bubble there's an airplane at an airport Why am I dreaming about a plane, if I am actually even dreaming? If so, this is a really ... far, that nobody's had the exact same talents as you have, at least not quite as accurate I mean, we've had, and still have Seers, but nothing as advanced as you I suppose you'll be like a test ... you saw a plane crash?" Mom sits back on her legs and shakes her head "That migraine pain must have really put your brain in a tizzy.” A tizzy? I've grown up hearing that word “Yeah, the pain...

Ngày tải lên: 06/11/2012, 16:14

... sinh giải thích hoạt động lớp vỏ Trái Đất đ a biện pháp để hạn chế thiệt hại thiên tai gây Học sinh thể kết học tập hình thức sản phẩm khác nhau: cẩm nang, ấn phẩm giải thích dự án sản phẩm khác ... quan tâm, đoàn kết sống cộng đồng + HS sử dụng Internet để nâng cao kiến thức thân Kịch giúp học sinh liên hệ học đến sống thật? + Bạn du lịch Nhật Bạn gặp sóng thần Bạn may mắn sống sót sau ... h a Nhưng nhiều người với bạn không may mắn + Bạn nước nhận việc phổ biến kiến thức động đất, núi l a, sóng thần cho cộng đồng cần thiết + Bạn lên kế hoạch để thực dự định Học sinh đóng vai...

Ngày tải lên: 18/01/2013, 10:25

... difficult to learn a new language? I cannot answer it but I am sure that learning a new language is a skill, not an art An art, such as painting, might require talent at some level, a skill does ... brain starts to draw a new map as you learn a new language The input signals you get via your eyes (reading) and ears (listening) stimulate the cells in the language processing area of your brain ... studies show that it is learning a new language that boosts your IQ, which means learning a foreign language makes you smarter, not that you must be smart to learn a new language This finding...

Ngày tải lên: 04/03/2013, 10:06

Ngày tải lên: 07/04/2013, 17:11

... implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: ... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern...

Ngày tải lên: 10/04/2013, 14:46