... verbal analogy problems, yielding 47% accuracy The same approach is applied to classifying noun-modifier pairs: using the Diverse dataset of Nastase and Szpakowicz (2003), Turney&Littman achieve ... 2.3 Paraphrase Acquisition Our method of extraction of paraphrasing verbs and prepositions is similar to previous paraphrase acquisition approaches Lin and Pantel (2001) extract paraphrases from ... (container, content, equative, material, measure, topic, type) For example, exam anxiety is classified as effect and therefore as CAUSALITY, and blue book is property and therefore also PARTICIPANT...
Ngày tải lên: 08/03/2014, 01:20
... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... several parameters: median measurements in the dark and light phases as well as 30 the regressed slope during each phase The startle peak in the velocity actogram was omitted from calculation because ... Larvae responded to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their speed decreased as they adapted to darkness The habituation effect can also...
Ngày tải lên: 15/05/2015, 00:37
Lab 4.1.4 Creating a Network Map using CDP
... 1700 FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial (S1) 2500 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 2600 FastEthernet 0/0 FastEthernet 0/1 (FA0/1) Serial 0/0 (S0/0) Serial ... typing enable If prompted for a password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged EXEC mode, enter the command erase startup-config ... interface chart does not include any other type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation...
Ngày tải lên: 04/11/2013, 16:15
Tài liệu Creating a Command Object Using Visual Studio .NET docx
... here Add the CustomerID, CompanyName, and ContactName columns using Query Builder, as shown in Figure 8.3 Figure 8.3: Adding the CustomerID, CompanyName, and ContactName columns to the query using ... the right of the CommandText property for your SqlCommand object In the Add Table dialog, select the Customers table, as shown in Figure 8.2 Click the Add button to add the Customers table to your ... Click the Close button to continue Figure 8.2: Adding the Customers table to the query using the Add Table dialog Next, you construct your query using Query Builder You select the columns you want...
Ngày tải lên: 21/01/2014, 07:20
Tài liệu Creating a Connection Object Using Visual Studio .NET pdf
... Entering the connection details Warning For security reasons, not enable the Allow Saving Password check box If you did, your password would be stored in the actual code, and anyone could get your password ... correct At this point, you've entered all the mandatory details, and you can choose to save your details by clicking OK, or you can click Advanced to enter additional details such as the connection ... password from the code Leave Allow Saving Password in its default non-enabled state; that way, the user will be prompted to enter the password For testing purposes, however, leaving your password in...
Ngày tải lên: 21/01/2014, 07:20
Tài liệu Creating a DataAdapter Object Using Visual Studio .NET doc
... UPDATE, and DELETE statements along with the table mappings Figure 10.12 shows the final dialog box for the Data Adapter Configuration Wizard Figure 10.12: Final dialog box for the Data Adapter ... This link allows you to re-enter the Wizard to configure your DataAdapter Generate Dataset This link allows you to generate a DataSet object using the information set for your DataAdapter You'll ... SqlDataAdapter object in the tray Warning You need to set the Connection property of the SelectCommand in your sqlDataAdapter1 object to your Connection object before the DataAdapter can access the...
Ngày tải lên: 21/01/2014, 07:20
Tài liệu Creating a DataSet Object Using Visual Studio .NET docx
... sqlConnection1.Open(); sqlDataAdapter1.Fill(dataSet11, "Products"); sqlConnection1.Close(); System.Data.DataTable myDataTable = dataSet11.Tables["Products"]; foreach (System.Data.DataRow myDataRow in myDataTable.Rows) ... Figure 10.15: The new DataSet object in the tray Your next step is to set the Form1_Load() method of your form as follows: private void Form1_Load(object sender, System.EventArgs e) { sqlConnection1.Open(); ... listView1.Items.Add(myDataRow["ProductID"].ToString()); listView1.Items.Add(myDataRow["ProductName"].ToString()); listView1.Items.Add(myDataRow["UnitPrice"].ToString()); } } Note Remember, to view the code...
Ngày tải lên: 21/01/2014, 07:20
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
... skill The time for the test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed ... When asked for the reason, they all argued that because they were always curious about the content of the songs, this task is really helpful as it enables them to have a full understanding of the ... table, it can be seen that class A is inferior to class B in the below average marks but it outnumbers class B in the above average marks In addition, if in the pre-test mode, class A is at the second...
Ngày tải lên: 29/01/2014, 10:33
Tài liệu Evaluation of physical activity programmes for elderly people - a descriptive study using the EFQM’ criteria ppt
... results n The organization has measures and/or indicators of customers’ satisfaction % 20 76,92 The organization has measures and/or indicators of customers’ loyalty 34,62 The organization has measures ... organizations have made recommendations for their specific programme, namely the American Association of Cardiovascular and Pulmonary Rehabilitation (AACVPR), which states that the programme leaders are ... organization has measures and/or indicators of people’s absenteeism 18 69,23 The organization has measures and/or indicators of people’s loyalty 26,92 The organization has measures and/or indicators...
Ngày tải lên: 14/02/2014, 06:20
delphi - creating a database application using delphi
... and save it The Data Controls page provides data-aware controls that work with data in a database and build a user interface You’ll display the database in a grid and add a few commands and a navigation ... such as a grid so that users can edit and post data to the database The data access components include the data source, the client dataset, the data provider, a unidirectional dataset, and a connection ... unidirectional dataset A unidirectional dataset reads data from the database but doesn’t update data To add the unidirectional dataset: From the dbExpress page, drop TSQLDataSet at the top of the form...
Ngày tải lên: 16/04/2014, 11:13
delphi - tutorial - creating a text editor using delphi
... current name The SaveAs dialog box is defined in the event handler for the Save As command on page -22 FileSaveAsExecute is the automatically generated name for the Save As command Your event handler ... can access each panel you create based on its unique index value By default, the first panel has a value of Each time you click Add, you add an additional panel to the status bar Tip You can also ... handler For the standard actions, such as the File|Exit and Edit|Paste commands, the events are included in the code However, for some of the standard actions, such as the File |Save As command,...
Ngày tải lên: 16/04/2014, 11:15
A Component Unit of the State of Montana Consolidated Statements of Net Assets_part1 doc
... our audit in accordance with auditing standards generally accepted in the United States of America Those standards require that we plan and perform the audit to obtain reasonable assurance about ... Technology Brandi Foster Dean/CEO Associate Dean for Academic Affairs Russ Fillner Assistant Dean/Fiscal and Plant Valerie Lambert Director of Financial Aid For additional information concerning on The ... financial audit is a component of the biennial financial-compliance audit Financial and financial‑related audits are combined for a two-year period to constitute the financial‑compliance audit...
Ngày tải lên: 18/06/2014, 20:20
A Component Unit of the State of Montana Consolidated Statements of Net Assets_part2 pot
... cost less accumulated depreciation Capital assets are classified as depreciable and non-depreciable Depreciation is treated as an operating expense Assets and liabilities are treated as current ... increase attributable to additional intercollegiate athletics event ticket sales and game guarantees, and additional special event ticket sales An increase in educational department sales and ... earned, and expenses are reported when incurred Assets and liabilities presented in the financial statements are generally measured at current value, although capital assets are stated at historical...
Ngày tải lên: 18/06/2014, 20:20
A Component Unit of the State of Montana Consolidated Statements of Net Assets_part3 pot
... CAPITAL ASSETS Capital assets are stated at cost or fair market value at date of purchase or donation Renovations to buildings, infrastructure, and land improvements that significantly increase ... part of the State of Montana Basic Financial Statements, which are prepared annually and presented in the Montana Comprehensive Annual Financial Report (CAFR) The University, as a political subdivision ... principles, as prescribed by the Governmental Accounting Standards Board (GASB) Under GASB Statement No 34, “Basic Financial Statements and Management Discussion and Analysis for State and Local Governments”...
Ngày tải lên: 18/06/2014, 20:20
A Component Unit of the State of Montana Consolidated Statements of Net Assets_part4 docx
... June 30, 2008, the swaption has a negative fair value of $2,309,206 Such value was provided to the University by the counterparty, and was calculated as an approximation of market value derived ... collateral, priced at 102 percent market value, to the designated State of Montana Federal Reserve Bank account.” The TFBP”s State Street repurchase agreement was purchased in the State of Montana ... Investments and the borrowers maintained the right to terminate all securities lending transactions on demand The cash collateral received on each loan was invested, together with the cash collateral...
Ngày tải lên: 18/06/2014, 20:20
A Component Unit of the State of Montana Consolidated Statements of Net Assets_part5 pot
... $78,187,418, all of which was unfunded The funded status of the plan as of June 30, 2008 was as follows: Actuarial accrued liability (AAL) Actuarial value of plan assets Unfunded actuarial accrued liability ... Variable Variable Variable Variable Variable Variable Variable Variable Variable Variable Variable Maturity Date 15-Feb-09 15-Aug-08 15-Aug-10 15-Feb-12 15-Feb-10 15-Aug-16 15-Aug-08 15-Aug-14 15-Aug-08 ... The UAAL is being amortized as a level dollar amount over an open basis of 30 years Actuarial valuations of an ongoing plan involve estimates of the value of reported amounts and assumptions about...
Ngày tải lên: 18/06/2014, 20:20
A Component Unit of the State of Montana Consolidated Statements of Net Assets_part6 pot
... to the Consolidated Financial Statements (continued) NOTE 24 – NATURAL CLASSIFICATION WITH FUNCTIONAL CLASSIFICATIONS The University’s operating expenses by natural and functional classifications ... University of Montana Foundation * Cash and investments Other receivables, net of allowances Fixed assets, net of depreciation Other assets Current liabilities associated with operations $ 161,413,732 ... depreciation Other assets Current liabilities associated with operations Note payable – other Long-term liabilities - other Liabilities to external beneficiaries Custodial funds STATEMENT OF FINANCIAL POSITION...
Ngày tải lên: 18/06/2014, 20:20
the university of Montana a Component unit of the state of Montana_part1 ppt
... fiscal year 2005-06 is based on the audit we performed in the fall of 2006 This financial audit is a component of the biennial financial-compliance audit Financial and financial‑related audits are ... combined for a two-year period to constitute the financial‑compliance audit We issue the financial-related audit every other year and a financial audit every year The financial‑related audit was issued ... our audit in accordance with auditing standards generally accepted in the United States of America Those standards require that we plan and perform the audit to obtain reasonable assurance about...
Ngày tải lên: 18/06/2014, 20:20
the university of Montana a Component unit of the state of Montana_part2 potx
... of the increase attributable to additional intercollegiate athletics event ticket sales and game guarantees, and additional special event ticket sales An increase in educational department sales ... grants and contracts State and local grants and contracts Nongovernmental grants and contracts Grant and contract facilities and administrative cost allowances Sales and services of educational ... Unit of the State of Montana Consolidated Statements of Net Assets A- 13 As of June 30,2007 and 2006 2007 ASSETS Current Assets Cash and cash equivalents (note 3) Securities lending collateral Investments...
Ngày tải lên: 18/06/2014, 20:20
the university of Montana a Component unit of the state of Montana_part3 pot
... Cash and cash equivalents classified as noncurrent assets Total Cash and Cash Eauivalents End of Year $ Reconciliation of Cash and Cash Equivalent to the Statement of Net Assets This is trial ... for the University are included as a component part of the State of Montana Basic Financial Statements, which are prepared annually and presented in the Montana Comprehensive Annual Financial ... make estimates and assun~ptionsthat affect the reported amounts of assets and liabilities and the disclosure of contingent assets and liabilities at the date of the financial statements, and the...
Ngày tải lên: 18/06/2014, 20:20