creating a component interface using the save as interface

Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx

Ngày tải lên : 08/03/2014, 01:20

... verbal analogy problems, yielding 47% accuracy The same approach is applied to classifying noun-modiﬁer pairs: using the Diverse dataset of Nastase and Szpakowicz (2003), Turney&Littman achieve ... 2.3 Paraphrase Acquisition Our method of extraction of paraphrasing verbs and prepositions is similar to previous paraphrase acquisition approaches Lin and Pantel (2001) extract paraphrases from ... (container, content, equative, material, measure, topic, type) For example, exam anxiety is classiﬁed as effect and therefore as CAUSALITY, and blue book is property and therefore also PARTICIPANT...

9
390
0

luận văn Toxicity assessment of small molecules using the zebrafish as a model system

Ngày tải lên : 15/05/2015, 00:37

... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... several parameters: median measurements in the dark and light phases as well as 30 the regressed slope during each phase The startle peak in the velocity actogram was omitted from calculation because ... Larvae responded to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their speed decreased as they adapted to darkness The habituation effect can also...

58
262
0

Lab 4.1.4 Creating a Network Map using CDP

Ngày tải lên : 04/11/2013, 16:15

... 1700 FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial (S1) 2500 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 2600 FastEthernet 0/0 FastEthernet 0/1 (FA0/1) Serial 0/0 (S0/0) Serial ... typing enable If prompted for a password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged EXEC mode, enter the command erase startup-config ... interface chart does not include any other type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation...

4
505
0

Tài liệu Creating a Command Object Using Visual Studio .NET docx

Ngày tải lên : 21/01/2014, 07:20

... here Add the CustomerID, CompanyName, and ContactName columns using Query Builder, as shown in Figure 8.3 Figure 8.3: Adding the CustomerID, CompanyName, and ContactName columns to the query using ... the right of the CommandText property for your SqlCommand object In the Add Table dialog, select the Customers table, as shown in Figure 8.2 Click the Add button to add the Customers table to your ... Click the Close button to continue Figure 8.2: Adding the Customers table to the query using the Add Table dialog Next, you construct your query using Query Builder You select the columns you want...

3
378
0

Tài liệu Creating a Connection Object Using Visual Studio .NET pdf

Ngày tải lên : 21/01/2014, 07:20

... Entering the connection details Warning For security reasons, not enable the Allow Saving Password check box If you did, your password would be stored in the actual code, and anyone could get your password ... correct At this point, you've entered all the mandatory details, and you can choose to save your details by clicking OK, or you can click Advanced to enter additional details such as the connection ... password from the code Leave Allow Saving Password in its default non-enabled state; that way, the user will be prompted to enter the password For testing purposes, however, leaving your password in...

7
380
0

Tài liệu Creating a DataAdapter Object Using Visual Studio .NET doc

Ngày tải lên : 21/01/2014, 07:20

... UPDATE, and DELETE statements along with the table mappings Figure 10.12 shows the final dialog box for the Data Adapter Configuration Wizard Figure 10.12: Final dialog box for the Data Adapter ... This link allows you to re-enter the Wizard to configure your DataAdapter Generate Dataset This link allows you to generate a DataSet object using the information set for your DataAdapter You'll ... SqlDataAdapter object in the tray Warning You need to set the Connection property of the SelectCommand in your sqlDataAdapter1 object to your Connection object before the DataAdapter can access the...

4
343
0

Tài liệu Creating a DataSet Object Using Visual Studio .NET docx

Ngày tải lên : 21/01/2014, 07:20

... sqlConnection1.Open(); sqlDataAdapter1.Fill(dataSet11, "Products"); sqlConnection1.Close(); System.Data.DataTable myDataTable = dataSet11.Tables["Products"]; foreach (System.Data.DataRow myDataRow in myDataTable.Rows) ... Figure 10.15: The new DataSet object in the tray Your next step is to set the Form1_Load() method of your form as follows: private void Form1_Load(object sender, System.EventArgs e) { sqlConnection1.Open(); ... listView1.Items.Add(myDataRow["ProductID"].ToString()); listView1.Items.Add(myDataRow["ProductName"].ToString()); listView1.Items.Add(myDataRow["UnitPrice"].ToString()); } } Note Remember, to view the code...

3
350
0

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

Ngày tải lên : 29/01/2014, 10:33

... skill The time for the test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed ... When asked for the reason, they all argued that because they were always curious about the content of the songs, this task is really helpful as it enables them to have a full understanding of the ... table, it can be seen that class A is inferior to class B in the below average marks but it outnumbers class B in the above average marks In addition, if in the pre-test mode, class A is at the second...

39
1.1K
3

Tài liệu Evaluation of physical activity programmes for elderly people - a descriptive study using the EFQM’ criteria ppt

Ngày tải lên : 14/02/2014, 06:20

... results n The organization has measures and/or indicators of customers’ satisfaction % 20 76,92 The organization has measures and/or indicators of customers’ loyalty 34,62 The organization has measures ... organizations have made recommendations for their specific programme, namely the American Association of Cardiovascular and Pulmonary Rehabilitation (AACVPR), which states that the programme leaders are ... organization has measures and/or indicators of people’s absenteeism 18 69,23 The organization has measures and/or indicators of people’s loyalty 26,92 The organization has measures and/or indicators...

16
959
0

delphi - creating a database application using delphi

Ngày tải lên : 16/04/2014, 11:13

... and save it The Data Controls page provides data-aware controls that work with data in a database and build a user interface You’ll display the database in a grid and add a few commands and a navigation ... such as a grid so that users can edit and post data to the database The data access components include the data source, the client dataset, the data provider, a unidirectional dataset, and a connection ... unidirectional dataset A unidirectional dataset reads data from the database but doesn’t update data To add the unidirectional dataset: From the dbExpress page, drop TSQLDataSet at the top of the form...

22
762
0

delphi - tutorial - creating a text editor using delphi

Ngày tải lên : 16/04/2014, 11:15

... current name The SaveAs dialog box is defined in the event handler for the Save As command on page -22 FileSaveAsExecute is the automatically generated name for the Save As command Your event handler ... can access each panel you create based on its unique index value By default, the first panel has a value of Each time you click Add, you add an additional panel to the status bar Tip You can also ... handler For the standard actions, such as the File|Exit and Edit|Paste commands, the events are included in the code However, for some of the standard actions, such as the File |Save As command,...

32
531
0