create database in mongodb c
How to Create an Oracle9i Database in a UNIX Environment pdf
Ngày tải lên: 29/03/2014, 16:20
MAKING A CHART OF THE ENERGY CONSUMPTION IN H.C.M. CITY
... Q5 ACTION PLAN MAKING A CHART OF THE ENERGY CONSUMPTION IN H .C. M. CITY ACTIVITIES All Ss .in each group should do their real assignement to be able to collect the own amounts of the city ... duty Completing the group’s duty 7 7 Having the creative combination’s Having the creative combination’s ideas ideas +1 +1 Having plenty of properly Having plenty of properly illustrated pictures illustrated ... without being applied for live society. • Interactive learning is impossible without pairworks and groupworks. And learning or teaching in the 21st century must always be put in the 4L situation...
Ngày tải lên: 22/07/2013, 01:27
Database Programming with C#
... more useful than a constraint in some situations, because a trigger can access columns in other tables, unlike a constraint, which can only access columns in the current table or row. If your code is to ... the connection 23 cnnUserMan = new SqlConnection(STR_CONNECTION_STRING); 24 cnnUserMan.Open(); 25 26 // Instantiate and initialize command 27 cmmUser = new SqlCommand(“SELECT * FROM viwUser”, cnnUserMan); 28 ... rows in the tblUser table when executed. You can see how you can call this stored procedure from code, in Listing 6-9. Listing 6-9. Running a Simple Oracle Stored Procedure 1 public void ExecuteSimpleOracleSP()...
Ngày tải lên: 27/10/2013, 07:15
Displaying an Image from a Database in a Web Forms Control
... that the client sees. The following steps outline the required tasks: 1. Create a web page that outputs a binary stream containing the image from the database. 2. Create a SQL statement to retrieve ... online sample code. [ Team LiB ] [ Team LiB ] Recipe 7.7 Displaying an Image from a Database in a Web Forms Control Problem You need to display an image from a database column in ... employeeImage Image control to the web page that serves the employee image, then a parameter passed in the URL indicates the employee ID to retrieve. The C# code for the code-behind is shown in Example...
Ngày tải lên: 28/10/2013, 18:15
Displaying an Image from a Database in a Windows Forms Control
... information, see the online sample code. Binding Windows Forms Controls The abstract BindingManagerBase class synchronizes all Windows Forms controls (i.e., Binding objects) that are bound to ... source so that they display information from the object within the data source, such as a row in a DataTable. The BindingContext class is used to instantiate a BindingManagerBase object and ... either a CurrencyManager or PropertyManager object is returned depending on the type of data source: • The CurrencyManager class inherits from the BindingManagerBase class and maintains a pointer...
Ngày tải lên: 28/10/2013, 18:15
Tài liệu Manual Creation of database in windows with oracle 9i ppt
... ceylonlinux_suranga as password to create db18 service like, oradim –new –sid db18 –intpwd ceylonlinux_suranga 5. Create a directory called db18. In my case I created it in d:\ drive (Note: all my parameter ... are going to discuss following are based on my location, you can change the location according to yours) 6. Here is my initdb18.ora that I saved it in d:\db18 folder. This is the static parameter ... during database creation or the re-creation of control files. 9. This step is to create the database using dbca.sql script that I saved in d:\db18 folder appears follows CREATE DATABASE db18...
Ngày tải lên: 25/01/2014, 05:20
Tài liệu Programming in Objective-C - Fourth Edition ppt
... 429 Using NSData to Create Custom Archives 436 Using the Archiver to Copy Objects 439 Exercises 441 20 Introduction to Cocoa and Cocoa Touch 443 Framework Layers 443 Cocoa Touch 444 21 Writing ... language source file .cc, .cpp C+ + language source file .h Header file .m Objective -C source file .mm Objective -C+ + source file .pl Perl source file .o Object (compiled) file Objective -C source files ... about its initial characteristics acquired from the factory, but also its current characteristics.Those charac- teristics can change dynamically.As you drive your car, the gas tank becomes depleted,...
Ngày tải lên: 18/02/2014, 12:20
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf
... quality control system, namely a Man 8 GlcNAc 2 -binding lectin (EDEM) [29,30], and SCF Fbs2 ubiquitin ligase com- plex, which specifically targets N-linked high-mannose- type oligosaccharide chains ... each plasmid using Lipofectamine Plus according to the manufacturer’s proto- col as described previously [13,14] and the transfected cells were incubated for 24 h in 5% CO 2 ⁄ 95% air (v ⁄ v) incuba- tor ... the manufacturer’s protocol. Transcrip- tion ⁄ translation was carried out with [ 35 S]methionine ⁄ cys- teine at 30 C for 90 min in the absence or presence of canine pancreatic microsomal membrane...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Building a Spatial Database in PostgreSQL pptx
... interface specifications that enable developers to write inter-operating components that provide these capabilities.” New Electoral Districts • Changes in areas between 1996 and 2001 election. • ... specification. • Understand the Specification – Much harder than it sounds • Add a GEOMETRY data type – Point / Multipoint – Linestring / Multilinestring – Polygon / Multipolygon – GeometryCollection • ... Relationships Stream side logging - adjacency and containment. Original Polygons Union Intersection Connectivity: Tributary relationships in river networks Advantages of Spatial Databases Simple value...
Ngày tải lên: 20/02/2014, 05:21
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx
... on pro- teins that contain exposed clusters of hydrophobic ami- noacyl residues, resulting in an increase in fluorescence [39]. ANS binding fluorescence of wild-type and mutant Hsp25 reached a maximum ... decrease in polarity of the C- terminal extension may also facili- tate interaction between the extension and hydro- phobic chaperone binding sites, resulting in the binding sites being less accessible ... & Chiou S-H (2002) C- terminal lysine truncation increases thermostability and enhances chap- erone-like function of porcine aB-crystallin. Biochem Biophys Res Commun 297 , 309–316. 54 Chang...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: Changes in specific lipids regulate BAX-induced mitochondrial permeability transition pptx
... medium contained CaCl 2 ; trace c, mitochondria incubated with 150 nM rBAX in the presence of calcium and CSA; trace d, mitochon- dria incubated with 150 n M rBAX without calcium; trace e, mitochondria ... We conclude that changes in cardiolipin content could not account for MbCD protection from mPTP opening, at least in control mitochondria, but may be important for rBAX insertion into the mitochondrial ... (Fig. 1C) . Cyclosporin A prevented cytochrome c release and mPTP opening induced by rBAX The immunosuppressant cyclosporin A (CSA) effec- tively inhibits mPTP opening under almost all condi- tions,...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... of which energy source is utilized, a class I c- type cytochrome, cyt c- 550, acting as an electron-car- rier is present in the respiratory chain which is homol- ogous to the cyts c 2 found in photosynthetic ... binding to class I c- type cytochromes. Arch Biochem Biophys 371, 142–148. 22 Dumortier C, Holt JM, Meyer TE & Cusanovich MA (1998) Imidazole binding to Rhodobacter capsulatus cytochrome c 2 : ... heme, sufficient movement of the loop containing the Met ligand connecting helices four and five must occur [19–22]. At present two X-ray struc- tures of cyts c 2 exist in which the coordinating Met- iron...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt
... Single-stranded DNA substrate (ssDNA70) was obtained by labeling 100 pmol of HPLC-purified primer WT (5¢-AATTGATCCCGCCCG CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA ACATGGCGCCGCTGCGGGGC-3¢) using 50 lCi ... [5¢- 32 P]-labeled S70ds ⁄ UP (5¢-AATT- GATCCCGCCCGCCTC-3¢) and S70ds ⁄ DN (5¢-GCCCCG CAGCGGCGCCATGTT-3¢) primers. For PCR, we added 2.5 · 10 )3 pmol of primer template, 50 pmol of each oligo- mer, 20 pmol of ... extracts, consistent with the truncation affecting part of domain X. Inter- estingly, mutants with shorter C- terminal truncations (DC14 and DC21) displayed no detectable splicing activity in vivo....
Ngày tải lên: 15/03/2014, 09:20
Báo cáo khoa học: Effects on protease inhibition by modifying of helicase residues in hepatitis C virus nonstructural protein 3 pot
... previously used gene construct for full-length HCV NS3 [9] were introduced by PCR using Q526A forward primer (5¢-TCCCGTGTGT GCAGACCATCTTGAAT-3¢), H528A forward primer (5¢-TCCCGTGTGTCAAGACGCTCTTGAAT-3¢) ... introduced side chain in uenced the charac- teristics of the enzyme. These results indicate that residues in the helicase domain of nonstructural protein 3 can in uence the protease, supporting our ... primer (5¢-TCCCGTGTGTCAAGACGCTCTTGAAT-3¢) or H 52 8S forward primer (5¢-TCCCGTGTGTCAAGACTCTCTTG AAT-3¢) and reverse primer (5¢-AGTCCCGGGGTGTT CATGTATGCTC-3¢). Each PCR vial contained 50 ng of template DNA, 0.2 mm dNTPs, 0.2...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: dehydrogenase from Arabidopsis thaliana, a flavoprotein involved in vitamin C biosynthesis pot
Ngày tải lên: 23/03/2014, 07:20
