create a required quantitative component for all training and fellowship awards

Tài liệu A COMPREHENSIVE QUANTITATIVE MODEL FOR ANALYZING BOND REFUNDING DECISIONS pptx

Tài liệu A COMPREHENSIVE QUANTITATIVE MODEL FOR ANALYZING BOND REFUNDING DECISIONS pptx

... and A. J Kalotay, “Optimal Bond Calling and Refunding,” Interfaces 9, 1979, pp 36-49 Brennan, M.J and E.S Schwartz, “Savings Bonds, Retractable Bonds and Callable Bonds,” Journal of Financial Economics ... Barnea, A. , R .A Haugen and L.W Senbet, A Rationale for Debt Maturity Structure and Call Provisions in the Agency Theoretic Framework,” Journal of Finance 35, 1980, pp 1223-1234 Boyce, W.M and ... 20 Journal of Financial and Strategic Decisions refunding decision (e.g., Brennan and Schwartz [3] and Kraus [4]) For example, Thatcher and Thatcher [9] empirically tested the timing...

Ngày tải lên: 15/02/2014, 13:20

9 357 1
Global Health in Medical Education: A Call for More Training and Opportunities pptx

Global Health in Medical Education: A Call for More Training and Opportunities pptx

... Several associations, organizations, and institutions have recently created scholarships and fellowships for medical students to pursue international research and training The Global Health Education ... A core curriculum for international health: evaluating 10 year’s experience at the University of Arizona Acad Med 1992;67:90–94 42 International Health Group Global Health Pathway Available at: ... education At the same time, more quantitative data on global health in medical education should be collected Teaching the global aspects of medicine and understanding medical resources and care...

Ngày tải lên: 14/03/2014, 21:20

5 640 0
báo cáo khoa học: "A consensus linkage map for molecular markers and Quantitative Trait Loci associated with economically important traits in melon (Cucumis melo L.)" pptx

báo cáo khoa học: "A consensus linkage map for molecular markers and Quantitative Trait Loci associated with economically important traits in melon (Cucumis melo L.)" pptx

... merged map, AD assisted in the map merging, prepared tables, and graphic representations and helped to draft the manuscript PZ and JB formatted the data for representation with C-maps for publication ... the Cucurbitaceae research community for next generation genomic and Page 10 of 14 genetic studies All the individual maps, the integrated map, marker and QTL information are available at ICuGI ... Recerca i Tecnologia Agroalimentàries, Spain; NITVS, National Institute of Vegetable and Tea Science, Japan; NERCV, National Engineering Research Center for Vegetables, China; and USDA-ARS U S Department...

Ngày tải lên: 11/08/2014, 11:21

14 420 0
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

... feedback linearization scheme is based on a coordinate transformation and an input transformation as well But the main advantage of the Park transformation is to define an internal state variable ... non-sinusoidal emf's In this case, however, a Park-like transformation can be defined We propose therefore in this paper a new transformation which preserves the same advantages as the Park transformation ... saturation, L, and M, are constant ara arb , and arc the rotor fluxes induced in the stator phases are The electrical equations of the machine can therefore be written as follows : are the backemf...

Ngày tải lên: 03/01/2014, 19:44

8 518 1
Tài liệu Glycemic Load Diet: A POWERFUL NEW PROGRAM FOR LOSING WEIGHT AND REVERSING INSULIN RESISTANCE pdf

Tài liệu Glycemic Load Diet: A POWERFUL NEW PROGRAM FOR LOSING WEIGHT AND REVERSING INSULIN RESISTANCE pdf

... contain it are so familiar to us We’ve been eating bread, potatoes, and rice all our lives, as have our parents and grandparents Indeed, many people can get away with eating large amounts of starch ... with a rise in popularity of vegetarianism and a period of rampant inflation of meat and dairy product prices The result was an abrupt shift in eating patterns away from eggs, red meat, and dairy ... quickly transform carbohydrates to fat and fat to carbohydrates People can get just as fat eating carbs as they can eating fat In fact, unlike fat, carbohydrates stimulate your pancreas to secrete...

Ngày tải lên: 15/02/2014, 15:20

242 2,9K 0
Tài liệu Báo cáo khoa học: "A SPEECH-FIRST MODEL FOR REPAIR DETECTION AND CORRECTION" docx

Tài liệu Báo cáo khoa học: "A SPEECH-FIRST MODEL FOR REPAIR DETECTION AND CORRECTION" docx

... glottalization is usually associated with fragments, not all fragments are glottalized In our database, 62% of fragments are not glottalized, and 9% of glottalized reparanda offsets are not fragments ... TI repair utterances 6We performed the same analysis for the last and first syllables in the reparandum and repair, respectively, and for normalized f0 and energy; results did not substantially ... for a spoken language corpus In Proceedings of the Speech and Natural Language Workshop, pages 7-14, Harriman NY, February DARPA, Morgan Kaufmann Christine Nakatani and Julia Hirschberg 1993 A...

Ngày tải lên: 20/02/2014, 21:20

8 502 0
Tài liệu Báo cáo khoa học: "A Pattern Matching Method for Finding Noun and Proper Noun Translations from Noisy Parallel Corpora" doc

Tài liệu Báo cáo khoa học: "A Pattern Matching Method for Finding Noun and Proper Noun Translations from Noisy Parallel Corpora" doc

... m a n judges (El-E3) Evaluator E1 is a native Cantonese speaker, E2 a Mandarin speaker, and E3 a speaker of both languages The results are shown in Figure The average accuracy for all evaluators ... generalize to Asian languages? In Pro- ceedings of Pacific Asia Conference on Formal and Computational Linguistics CHURCH, KENNETH 1993 Char_align: A program for aligning parallel texts at the character ... N candidate evaluation is useful because in a machine-aided translation system, we could propose a list of up to, say, ten candidate translations to help the translator We obtained the evaluations...

Ngày tải lên: 20/02/2014, 22:20

8 427 0
Tài liệu A Guide to Recovery for Compulsive Debtors and Spenders By Linda Isaacson (pseudonym) ppt

Tài liệu A Guide to Recovery for Compulsive Debtors and Spenders By Linda Isaacson (pseudonym) ppt

... emotionally lash out at someone, re-evaluate your amends before you make it I have seen people make an amends and add a “but” at the end, as in, “I was wrong to call you a jerk … but you really made ... minutes for the call After that, I will go about my day and if the sponsee calls after that, I may not be able to take the call Worse, I have had sponsees simply not call for a day or more, having ... judging, and hating, is all it takes Just try That’s all Step Made a list of all persons we had harmed, and became willing to make amends to them all Principle: Humility Apologizing, especially when...

Ngày tải lên: 21/02/2014, 14:20

232 3,4K 0
Tài liệu Cities for All Proposals and Experiences towards the Right to the City docx

Tài liệu Cities for All Proposals and Experiences towards the Right to the City docx

... longer a matter of accepting what Margaret Thatcher said, that 13 There is no alternative, and we say that there has to be an alternative There has to be an alternative to capitalism in general And ... interests We are left to wait for institutional politics, areas of research and intellectual debate and local and global movements to engage in exchange and transfers to create the foundations of a political ... fair and effective social and economic development; to create a mechanism for upward social mobility that reaches low-income sectors and groups which are discriminated against and excluded; and...

Ngày tải lên: 25/02/2014, 01:20

326 398 0
Design accessible web sites 36 Keys to Creating Content for All Audiences and Platforms potx

Design accessible web sites 36 Keys to Creating Content for All Audiences and Platforms potx

... targeted toward a specific professional audience, there may already be a style guide available The American Psychological Association (APA), Modern Language Association (MLA), and the American ... LAN FOR A CCESS the formats or be in a form that can be converted (preferably automatically) for each target We will also need to provide appropriate data for alternative access By way of example, ... LAN FOR A CCESS appropriate for the content at hand and handle the styling separately We’ll talk more about tagging for meaning in Say It With Meaning, on page 83 If you really want to emphasize...

Ngày tải lên: 05/03/2014, 11:21

303 1,1K 0
Which interest rate scenario is the worst one for a bank? Evidence from a tracking bank approach for German savings and cooperative banks potx

Which interest rate scenario is the worst one for a bank? Evidence from a tracking bank approach for German savings and cooperative banks potx

... empirical analysis using a large German panel data set Fred Ramb 26 22 2007 Volatile multinationals? Evidence from the labor demand of German firms Claudia M Buch Alexander Lipponer 23 2007 International ... 34 2007 Factor-MIDAS for now- and forecasting with ragged-edge data: a model comparison for German GDP Massimiliano Marcellino Christian Schumacher 35 2007 Monetary policy and core inflation Michele ... quality of banking and regional growth Hasan, Koetter, Wedow 11 2007 Welfare effects of financial integration Fecht, Grüner, Hartmann 12 2007 The marketability of bank assets and managerial Falko...

Ngày tải lên: 22/03/2014, 23:20

40 468 0
Báo cáo khoa học: "A GENERATIVE GRAMMAR APPROACH FOR THE MORPHOLOGIC AND MORPHOSYNTACTIC ANALYSIS OF ITALIAN" ppt

Báo cáo khoa học: "A GENERATIVE GRAMMAR APPROACH FOR THE MORPHOLOGIC AND MORPHOSYNTACTIC ANALYSIS OF ITALIAN" ppt

... This grammar can both generate from a given lemma all the current Italian words deriving from it and analyze a given word by 33 lemma I stem matte mattino di andare andare matt mattin di vad and ... U.Bortolini, C.Tagliavini and A. Zampolli, Lessico di freq.enza delia lingua italiana contemporanea, ed IBM, 1971 161 B.Bottini and M.Cappelli, Un Meta Analizzatore Orienial al Linguaggio Natnrale in Ambiente ... preanalyser and to produce for every form analyzed the list of all its characteristics: I tlere are some example of words analyzed with this grammar: The grammar for the DATE Numbers are...

Ngày tải lên: 24/03/2014, 05:21

6 378 0
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

... methods and analyzed with a microscope, BZ-8100 (Keyence, Osaka, Japan) Acknowledgements We greatly appreciate Dr Masatoshi Maki and Dr Hideki Shibata in our laboratory for providing valuable suggestions ... Q-x-P-WD-P to TGase and Q-x-x-W-x-W-P to Factor XIII (x and W are any amino acid and hydrophobic amino acid residues, respectively) We applied a similar approach to obtain information regarding the ... recombinant human TGases 1, -2 and -3 and purified guinea-pig liver TGase were purchased from Zedira (Darmstadt, Germany) and Sigma (St Louis, MO, USA) For the activation of TGase 3, the zymogen was...

Ngày tải lên: 29/03/2014, 21:20

11 645 0
Designing a supply chain Proposition for improving quality and overall productivity of enterprises using business model

Designing a supply chain Proposition for improving quality and overall productivity of enterprises using business model

... in table 2.1) based on its operations and activities and two sections financial and non-financial and are explained as follows: 2.8.1 Strategic Strategic level performance measures are the measures ... collaborative • Coordination of information sharing: Partially or fully shared 2.8 SUPPLY CHAIN PERFORMANCE MEASURES Assessing the supply chains performance periodically is as vital as managing ... either can be tangible assets (land, plant, warehouse, machines, work force (humans) capital etc or can be intangible assets (reputation, market value, patents, trademarks etc.) (Osterwalder and...

Ngày tải lên: 01/06/2014, 13:59

113 353 0
Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf

Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf

... CACAGGAAACAGCTATGACC GATGTTACTCGTGGATCTGG CATGATCAACTGCTCTGATTAC GGGCTTCCCGTACTTTGTG TGGATTTAGCTCCCTGAATG TYLCV primers for Q-PCR (176 bp amplicon) Ty 2164+ Ty 2339- CTAAGAGCCTCTGACTTACTGC AACATTCAGGGAGCTAAATCCAG ... http://www.virologyj.com/content/5/1/135 (A) A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI SacI T A A T C G T G G C G C C G AAG CGCCTTTTCCT original viral sequence ... Holland JJ: Mutation rates among RNA viruses Proc Natl Acad Sci USA 1999, 96:13910-13913 Garcia-Arenal F, Fraile A, Malpica JM: Variability and genetic structure of plant virus populations Ann...

Ngày tải lên: 20/06/2014, 01:20

10 396 0
Báo cáo hóa học: " Research Article Hierarchical Convergence of a Double-Net Algorithm for Equilibrium Problems and Variational Inequality Problems" ppt

Báo cáo hóa học: " Research Article Hierarchical Convergence of a Double-Net Algorithm for Equilibrium Problems and Variational Inequality Problems" ppt

... Fix T such that Ax, x − x ≥ 0, ∀x ∈ Fix T , 1.7 a variational inequality studied by Yamada and Ogura 10 A Example 1.3 Let A be a maximal monotone operator Taking T Jλ : I A −1 and P I − γ∇ψ, ... Muglia, and Y Yao, “On a two-step algorithm for hierarchical fixed point problems and variational inequalities,” Journal of Inequalities and Applications, vol 2009, Article ID 208692, 13 pages, ... hierarchical variational inequality problem and equilibrium problem 1.12 includes the variational inequality problem studied by Yamada and Ogura 10 , mathematical program studied by Luo et al 11 , hierarchical...

Ngày tải lên: 21/06/2014, 07:20

16 313 0
Báo cáo hóa học: " Research Article A General Iterative Method for Equilibrium Problems and Fixed Point Problems in Hilbert Spaces" pptx

Báo cáo hóa học: " Research Article A General Iterative Method for Equilibrium Problems and Fixed Point Problems in Hilbert Spaces" pptx

... − A) )(q) Remark 4.2 It is very clear that our algorithm with a variational regularization parameter {rn } has certain advantages over the algorithm with a fixed regularization parameter r In some ... Fl˚ m and A S Antipin, “Equilibrium programming using proximal-like algorithms,” a Mathematical Programming, vol 78, no 1, pp 29–41, 1997 Meijuan Shang et al [3] S Takahashi and W Takahashi, ... Mathematical Analysis and Applications, vol 318, no 1, pp 43–52, 2006 [9] A Moudafi, “Viscosity approximation methods for fixed-points problems,” Journal of Mathematical Analysis and Applications,...

Ngày tải lên: 21/06/2014, 22:20

9 243 0
Báo cáo hóa học: " Research Article A Boundary Harnack Principle for Infinity-Laplacian and Some Related Results" pdf

Báo cáo hóa học: " Research Article A Boundary Harnack Principle for Infinity-Laplacian and Some Related Results" pdf

... “Optimal Lipschitz extensions and the infinity Laplacian,” Calculus of Variations and Partial Differential Equations, vol 13, no 2, pp 123–139, 2001 [10] T Bhattacharya, E DiBenedetto, and J J Manfredi, ... Bhattacharya, A note on non-negative singular infinity-harmonic functions in the halfspace,” Revista Matem´ tica Complutense, vol 18, no 2, pp 377–385, 2005 a [8] G Aronsson, M G Crandall, and ... known for linear equations [3] and also for the linearized version for the p-Laplacian [4, 5] While we are able to prove the doubling property for any C domain (see Lemma 3.3), it is unclear how a...

Ngày tải lên: 22/06/2014, 22:20

17 294 0
How Are We Presenting: A Look At How We All Present And Where It All Goes Wrong

How Are We Presenting: A Look At How We All Present And Where It All Goes Wrong

... Presenter reads off screen Lack of understanding of audience's needs Lack of preparation/ practice 53% 49% 46% Tell stories, use visuals, be more human - less robot That’s all folks A huge thanks to ... organisation… …Makes sales as a direct result of presentations 65% Agree 27% Disagree 41% 24% 22% 5% Strongly Agree Agree Disagree Strongly Disagree 8% Unsure …Aims to develop employees presentation ... took part in the survey, and good luck with any presentations you might have in the near future! Find out a bit more about the creator of this survey The presentation was created by me, Ed, that’s...

Ngày tải lên: 21/07/2014, 11:53

44 385 1
Báo cáo y học: "Mast cell activation disease: a concise practical guide for diagnostic workup and therapeutic options" ppt

Báo cáo y học: "Mast cell activation disease: a concise practical guide for diagnostic workup and therapeutic options" ppt

... [50]) Signs and Symptoms Abdominal abdominal pain, intestinal cramping and bloating, diarrhea and/ or obstipation, nausea, non-cardiac chest pain, Helicobacter pylori-negative gastritis, malabsorption ... inhibitors for proven gastroesophageal reflux • Tachycardia⇒ verapamil; AT1-receptor antagonists; ivabradin • Neuropathic pain and paresthesia⇒ a- lipoic acid • Interstitial cystitis⇒ pentosan, amphetamines ... prostaglandin D , and prostaglandin 9a, 11bPGF ) Together with a characteristic clinical presentation, abnormal markers can be of diagnostic, therapeutic and prognostic relevance However, it remains...

Ngày tải lên: 10/08/2014, 21:23

8 260 0
w