... Compound Compound Compound Compound Compound Compound Caspase -3 Caspase Caspase Caspase Caspase 1.529 0. 537 0.859 0.657 0 .30 3 0.268 0. 233 0.149 0.1 13 0.068 0.064 0.055 0.0 53 0.040 0.474 0. 137 0.201 ... from compounds 1, 2, and is from [30 ] Caspase -3 Compound Compound Compound Compound Compound Compound Compound Calpain Proteasome Papain Trypsin Thrombin 0.149 0.1 13 0.068 0.064 0.055 0.0 53 0.040 ... 0.079 0.216 0 .38 6 0.218 0. 136 0.1 13 0.151 0.057 0.0 63 1.9 13 0. 835 1.122 2 .36 0 0.684 0.987 0.425 1.574 1 .30 0 1.640 1.811 0. 933 2.104 0.860 ± ± ± ± ± ± ± 0.241 0. 035 0.0 73 0.086 0.051 0. 032 0.027 ±...
Ngày tải lên: 07/03/2014, 11:20
... satisfy customer demands by its products and services However, it gains many benefits, the company’s image will be raised and its income will increase And the benefits that it gains come from customers, ... family, share of Bubble and Laser Page CANON VIETNAM CO LTD AND ITS MARKETING competitive advantage of a company, so Canon pays many costs to have Printer in Vietnam is 39 % and 42% (Cơ quan Đảng ... http://www.gso.gov.vn/default.aspx?tabid =39 5&idmid =3& ItemID=90 83 (Accessed 3rd January 2010) 27 VnEconomy, (2007), “Canon Việt Nam ngại hàng nhập lậu”, [Online], vneconomy, Available from link: Page 28 CANON VIETNAM CO LTD AND ITS...
Ngày tải lên: 06/09/2012, 11:05
Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt
... Structural analysis of 14 -3- 3phosphopeptide complexes identifies a 646 30 31 32 33 34 35 36 dual role for the nuclear export signal of 14 -3- 3 in ligand binding Mol Cell 4, 1 53 166 Frithz-Lindsten ... J 38 1, 32 9 34 2 Wurtele M, Jelich-Ottmann C, Wittinghofer A & Oecking C (20 03) Structural view of a fungal toxin acting on a 14 -3- 3regulatory complex Embo J 22, 987–994 Roberts MR (20 03) 14 -3- 3 ... equivalent amounts of 14 -3- 3 proteins (Fig 2, lanes 1 3 and 7–9) In contrast, diluted GST-ExoS(L426A) and GST-ExoS(L428A) precipitated fewer 14 -3- 3 proteins (Fig 2, lanes 4–6 and 10–12) Thus, the...
Ngày tải lên: 19/02/2014, 08:20
Báo cáo khoa học: Characterization of testis-specific serine–threonine kinase 3 and its activation by phosphoinositide-dependent kinase-1-dependent signalling doc
... Full-length human and mouse TSSK3 were subcloned from pUC18mTSSK3 FEBS Journal 272 (2005) 631 0– 632 3 ª 2005 The Authors Journal compilation ª 2005 FEBS 631 9 Characterization and regulation of TSSK3 M Bucko-Justyna ... phosphorylation of GST–TSSK3 with [32 P]ATP[cP] The phosphorylation reactions of GST–TSSK3K39R by Myc-PDK1 [32 ] immunoprecipitated from 293T cells and of HA–TSSK3K39R immunoprecipitated from 293T cells, by ... Biochemistry 40, 11851–11859 34 Anderson KE, Coadwell J, Stephens LR & Hawkins PT (1998) Translocation of PDK-1 to the plasma Characterization and regulation of TSSK3 35 36 37 38 39 40 membrane is important...
Ngày tải lên: 23/03/2014, 11:20
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... 432 2– 433 7 ª 2010 The Authors Journal compilation ª 2010 FEBS 433 3 Regulation of CARP by calpain 3 10 11 12 L Laure et al limb-girdle muscular dystrophy: clinical phenotypes in Reunion Island and ... motif-containing 63 (Trim 63) , NM_001 039 048 P0 Acidic ribosomal phosphoprotein XR_004667 433 2 Upper primer Probe Lower primer mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R ... from 71 to 31 9 Full-length CARP 1 31 9 CARP from 30 to 31 9 CARP from 71 to 31 9 CARP from 102 to 31 9 CARP from 124 to 31 9 CARP from to 70 pGAD-DNter2 pYFP-CARPCFP-HIS pDNter1 pDNter2 pDNter3 pDNter4...
Ngày tải lên: 29/03/2014, 21:20
methane and its derivatives (chemical industries) by sunggyu lee
... VI Storage and Peak–shaving 33 0 VII Natural Gas Fuel Cell 33 3 VIII Membrane Gas Separation 33 5 IX NOX and SOx Removal 33 8 X Sour Gas Processing 34 1 XI Natural Gas Vehicles of 31 1 34 4 3/ 1/2007 12:42 ... Methane Derivatives via Synthesis Gas I Ammonia 73 73 II Methanol and Derivatives III Oxochemicals 182 IV Phosgene and Derivatives of 116 190 3/ 1/2007 12:22 AM Document http://www.netlibrary.com/nlreader/nlreader.dll?bookid =34 957&fil ... http://www.netlibrary.com/nlreader/nlreader.dll?bookid =34 957&fil XII Hydrates 34 6 XIII Safety and Flammability 35 5 Environmental Issues of Methane Conversion Technology 36 1 I Methane Conversion Technologies 36 1...
Ngày tải lên: 02/04/2014, 15:59
Báo cáo toán học: "The cube polynomial and its derivatives: the case of median graphs" pps
... On compact median graphs, J Graph Theory 23 (1996) 32 5 33 6 [19] M van de Vel, Theory of Convex Structures (North Holland, Amsterdam, 19 93) [20] P Winkler, Isometric embeddings in products of complete ... to Bandelt and van de Vel [3] Namely, a connected graph is a median graph if and only if it can be obtained from hypercubes by a sequence of convex amalgamations, where a convex amalgamation consists ... journal of combinatorics 10 (20 03) , #R3 10 ˇ [9] S Klavˇar and R Skrekovski, On median graphs and median grid graphs, Discrete z Math 219 (2000) 287–2 93 ˇ [10] S Klavˇar, H M Mulder, and R Skrekovski,...
Ngày tải lên: 07/08/2014, 07:21
Báo cáo vật lý: "Synthesis of Hydroxyl Radical Scavengers from Benzalacetone and its Derivatives" pot
... Anisalacetone 30 60 2966; 2841 1598,9 15 73; 1419,5 1251–1178,4 Veratralacetone 30 30 2 939 ; 2 839 1618 1512; 1419,5 12 63 11 03 Cinnamalacetone 30 28 2854 1604 1569; 1446 - Dibenzalacetone 30 60 30 28 - 1651 15 93; ... benzalacetone and its derivatives were carried out by crossed aldol condensation between acetone and benzaldehyde and its derivatives. 17,18 The structures of benzalacetone and its derivatives are ... acetone:benzaldehyde and its derivatives yielded dibenzalacetone, dianisalacetone, diveratralacetone and dicinnamalacetone Table 3: The results of synthesis benzalacetone and its derivatives Product Color IC50...
Ngày tải lên: 07/08/2014, 14:20
Báo cáo y học: "ignal 3 and its role in autoimmunity" pot
... 2002, 189:51- 63 O’Sullivan B, Thomas R: CD40 and dendritic cell function Crit Rev Immunol 20 03, 23: 83- 107 Gill RG, Coulombe M, Lafferty KJ: Pancreatic islet allograft immunity and tolerance: ... IL-1ra in the constitutive maintenance of peripheral tolerance, and in counterbalancing the proinflammatory effects of IL-1 and IL-17 Conclusions Although apparently simple, the concept of a third ... naive CD4+ and CD8+ T cells J Immunol 1999, 162 :32 56 -32 62 Adorini L, Gregori S, Harrison LC: Understanding autoimmune diabetes: insights from mouse models Trends Mol Med 2002, 8 :31 -38 Luft T,...
Ngày tải lên: 09/08/2014, 01:23
Hydraulic modeling of open channel flows over an arbitrary 3-d surface and its applications in amenity hydraulic engineering
... the Riemann-Christoffel symbols: (m = 1,2 ,3) (3. 32) Substituting the conditions of orthogonality (Equations 3. 10 and 3. 11) into Equations (3. 30, 3. 31), and neglecting the effect of Reynold stress ... that: h p ∫ρ { ζ ζ ζ ζ dζ = UUΓ0ξ ξ + VUΓ0η ξ + UVΓ0 ξη + VVΓ0ηη − G ζ }h2 (3. 37) Equations (3. 26, 3. 33, 3. 34) and (3. 37) are the depth-averaged equations in a general form used in calculating ... = yη = (3. 3a) J ζ yξ z − ζ zξ y (3. 3b) J ξ yη z − ξ zη y (3. 3c) J η z ζ x − η xζ z (3. 4a) J ζ z ξ z − ζ xξ z (3. 4b) J 21 yζ = zξ = zη = zζ = ξ zη x − ξ xη z (3. 4c) J η xζ y − η yζ x (3. 5a) J...
Ngày tải lên: 06/11/2012, 10:35
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx
... 600 (E) -3- methylglutaconyl-5-CoA MW 8 93, 36 400 200 CoA (Z) -3- methylglutaconyl-5-CoA MW 8 93, 36 0 14 16 18 20 22 AUH AUH 24 AUH B 120 mAU 1000 100 800 CoA 600 600 HMG-CoA (E) -34 00 methylglutaconyl- ... 3- methylglutaconyl-CoA hydratase) Substrate Km (lM) (E) -3- Methylglutaconyl-1-CoA 8 .3 (R,S) -3- Hydroxy -32 250 methylglutaryl-CoA (E)-Glutaconyl-CoA 2.4 Crotonyl-CoA 12100 3- Hydroxybutyryl-CoA 55200 3- Methylcrotonyl-CoA ... data were collected using purified MBP-AUHp40 Enzymatic synthesis of 3- MG-CoA and glutaconyl-CoA The substrates 3- MG-CoA and glutaconyl-CoA were synthesized using recombinant glutaconate CoA-transferase...
Ngày tải lên: 19/02/2014, 07:20
Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf
... F structure (PDB 3if5) There are disordered regions in the F (35 4-4 03 and 449456 aa), N (35 4 -37 6, 39 5-401 and 446-456 aa), G (35 3 -35 9, 39 7-402 and 449-456 aa), T (449-456 aa) and TG (451-456 aa) ... 433 0 86 664 288 0 16 505 191 20 39 679 511 20 16 14 0.006 1 .30 40.8 0.008 1 .38 48.9 0.008 1. 43 70.4 0.007 1 .37 40.9 89.1 10.2 0.7 0 .32 88 .3 10.8 0.9 0 .36 85.7 13. 2 1.1 0.51 86.2 12.8 0.9 0 .34 ... 35 920 98.2 (99.6) 147 220 46 819 99.5 (98.6) 11.1 54.6 6.1 3. 6 (3. 6) 12.4 49.2 8.2 3. 7 (3. 7) 11.9 35 .6 8.7 3. 5 (3. 5) 13. 1 41.2 5.7 3. 1 (2.8) 118.08 142.25 74.25 90 104.1 90 42.1 117.70 141 .39 ...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Alpha-oxidation of 3-methyl-substituted fatty acids and its thiamine dependence pptx
... Lett 429, 225–228 32 Jansen, G.A., van den Brink, D.M., Ofman, R., Draghici, O., Dacremont, G & Wanders, R.J (2001) Identification of pristanal 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 ... [22, 23] 3Rfi2S,3R; 3Sfi2R,3S c [37 ,38 ] E coli Yes [22,24,25] Yes [25] TPP, Mg2+ [26] 15 lMd [26] Peroxisomal matrix [26,27] PTS-1 [26] Not stereospecific [38 ] Mammalian cells, S cerevisiae [26 ,39 ] ... degradation of 3- methyl-branched fatty acids in humans See text for details Acyl-CoA synthetase Phytanoyl-CoA hydroxylase (PAHX) 2-Hydroxyphytanoyl-CoA lyase (2-HPCL) Q9UJ 83 3p25 [39 ] Monomer: 63 732 Da...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Membrane trafficking of CD98 and its ligand galectin 3 in BeWo cells ) implication for placental cell fusion pot
... 28 29 30 31 32 33 34 35 36 family, contains a predicted transmembrane-spanning domain and a leucine zipper motif J Biol Chem 277, 18840–18848 Patterson RJ, Wang W & Wang JL (2004) Understanding ... [29 ,30 ], in this study we investigated the effect of BFA on the expression and the function of CD98 and its direct and indirect effect on galectin 3, which binds glycosylated proteins through its ... galectin-1 and galectin in human placenta correlates with the differentiation pathways of trophoblasts Placenta 18, 433 – 439 Vicovac L, Jankovic M & Cuperlovic M (1998) Galectin-1 and -3 in cells...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo Y học: Expression of uncoupling protein-3 in subsarcolemmal and intermyofibrillar mitochondria of various mouse muscle types and its modulation by fasting docx
... sequence between TM3 and TM4 of mouse and rat UCP3 (Lilly) C-Terminus of human UCP3, AB3046 (Chemicon) C-Terminus of human UCP3, AB3046 (Chemicon) C-Terminus of human UCP3, AB3046 (Chemicon) C-Terminus ... human UCP3, UCP32-A (a-Diagnostic) C-Terminus of human UCP3, UCP32-A (a-Diagnostic) C-Terminus of human UCP3, UCP32-A (a-Diagnostic) Peptide sequence between TM2 and TM3 of human UCP3, UCP31-A (a-Diagnostic) ... peroxidase-labeled secondary antibody To compare the UCP3 signals, linear standard curves were constructed using increasing concentrations of the human and mouse UCP3 recombinant proteins provided...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo khoa học: Recombinant expression of an insulin-like peptide 3 (INSL3) precursor and its enzymatic conversion to mature human INSL3 pot
... structural and functional studies of INSL3 because it can be prepared through recombinant expression more 5208 Fig cAMP activity of recombinant INSL3 and its precursor compared to synthetic INSL3 The ... (38 32 .3) of the expected B A Fig Enzymatic conversion of INSL3 precursor to mature human INSL3 (A) C18 reverse-phase HPLC of Lys-C digested INSL3 precursor (B) C18 reverse-phase HPLC of INSL3 ... Materials and methods FEBS Journal 276 (2009) 52 03 5211 ª 2009 The Authors Journal compilation ª 2009 FEBS X Luo et al A Recombinant expression of an INSL3 precursor a star) was 636 3.0 Da, consistent...
Ngày tải lên: 30/03/2014, 01:20
Báo cáo khoa học: Cholesterol and its anionic derivatives inhibit 5-lipoxygenase activation in polymorphonuclear leukocytes and MonoMac6 cells pot
... amount and its conversion to anionic derivatives FEBS Journal 2 73 (2006) 548–557 ª 2006 The Authors Journal compilation ª 2006 FEBS 5 53 Cholesterol sulfate inhibits 5-lipoxygenase D A Aleksandrov ... inhibits 5-LO product synthesis in MM6 and PMNL in a concentration-dependent manner MM6 and PMNL were preincubated for 30 at 37 °C with CS at the indicated concentrations with 20 lM AA, and then ... phosphatidylinositol -3- kinase [29], chymotrypsin [30 ], pancreatic elastase [31 ] and DNase I [32 ] CS also regulates transcription of transglutaminase I [33 ] Recently, it was shown that CS is a specific ligand for...
Ngày tải lên: 30/03/2014, 11:20
Mass Transfer in Multiphase Systems and its Applications Part 3 potx
... 10 -3- 10-2 m/s; 0.1 X = 0.25, 0.5 mass% n = 8 .33 - 13. 33 1/s; 0.145 d/D = 0.5 Vg = 0. 139 2.78 x10-4 m3/s ; X ≤ 10 % obj ηm =1 .3- 40.7 x1 03 Pas; Turbine with flat blades; PG-L-S/VL = 0.756 .3 kW/m3; Comments ... (0. 03- 0.1% mass.) solids: Al2O3, Fe2O3 kiselguhr, glass beads (dp = 50 -30 0 μm); sand (dp = 30 0 μm and powder); 185 exp points; Δ±11.5% Particles: CaCO3, Fe2O3, BaSO4, n [1/s] = const = 10. 83; ... ∈ No Impeller A B C ±Δ, % Rushton Turbine CD A 31 5 0.029 0.028 0.122 0.44 0 .37 4 0. 432 0. 534 0.622 0.79 3. 7 3. 3 5.2 Table The values of the coefficient A and exponents...
Ngày tải lên: 20/06/2014, 06:20
Sensor Fusion and its Applications Part 3 ppt
... Sensor Fusion and Its Applications Signal-1 4.7 0 1.6 3. 0 4.5 1.5 1.8 2.8 0.8 0 3. 0 3. 1 4.7 5.7 3. 7 1.6 2.4 1.8 4.7 2.4 0.8 3. 0 3. 7 2.2 1.8 2 .3 1 .3 1.6 3. 0 3. 1 2.7 Measured 4.7 6.7 2.7 1.6 3. 2 Level ... and not a constant as shown in equation (1) This is calculated by the common coefficients Kc and K j , if there are common coefficients in K j then one of the Kc coefficient is removed and the common ... Fusion and Its Applications References S Lowen and M Teich (1970) Power-Law Shot Noise, IEEE Trans Inform volume 36 , pages 130 2- 131 8, 1970 Slepian, D Wolf, J (19 73) Noiseless coding of correlated...
Ngày tải lên: 20/06/2014, 11:20
Insulin Action and Its Disturbances in Disease - part 3 pptx
... insulin-plus-glucose during amino acid infusion: studies of incorporation and turnover of tracer L-[1– 13 C]leucine Diabetologia 33 , 43 51 83 Bennet, W M., Connacher, A A., Jung, R T., Stehle, P and Rennie, ... Transgenic lipodystrophic adipose tissue Transgenic muscle 65 66 38 FIRKO LIRKO BIRKO NIRKO 32 35 36 37 63 64 55 55 67 68 34 , 33 136 GENETICALLY MODIFIED MOUSE MODELS OF INSULIN RESISTANCE 5.4 ... 17 03 1708 32 Mitch, W E., Medina, R., Grieber, S., May, R C., England, B K., Price, S R., Bailey, J L and Goldberg, A L (1994) Metabolic acidosis stimulates muscle protein REFERENCES 33 34 35 36 ...
Ngày tải lên: 09/08/2014, 15:20