core competencies of a training manager

... mild-acid hydrolysis and an oligosaccharide mixture (OS HOAc ) w as isolated by gel-permeation chromatograp hy on Sephadex G-50. Sugar analysis of OS HOAc by GLC of the acetylated alditols revealed ... Y .A. & K rohn, K. (1996) Immunochemic al characterization of O polysaccharid es compo- sing the a- D -rhamnose backbone of lipopolysaccharide of Pseu- domonas s yringae and classification of ... Mild acid degradation of the LPS gave the major glycoform 1 c ore octasaccharide and a minor trun- cated glycoform 2 core heptasaccharide, which resulted from the cleavage of the terminal Kdo residues....

Ngày tải lên: 23/03/2014, 13:20

... clinical skills, clinical training skills and advanced training skills, as well as the number of trainings each clinical trainer and advanced trainer had conducted since the training. Follow-Up Activities Drawing ... Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Bar- buda, Dominica, Grenada, and Turks & Caicos in 2005. Clinical Skills Course Data from ... information about course participants and trainers. Drawing from this database, a telephone survey followed up on program-trained VCT providers; an external evaluation analyzed data on VCT trainers. Results:...

Ngày tải lên: 18/06/2014, 17:20

... data were analysed by means of SAS software. Sum- mary statistics were generated with gender, type of pro- vider, type of facility, working status and reasons for leaving as the categorical variable. ... with regional health bureaux for effective retention strategies. The collection of all training data in one central database allowed access to a comprehensive list of providers trained at individual ... in Ethiopia Marion E McNabb 1 , Cynthia A Hiner* 1 , Anne Pfitzer 2 , Yassir Abduljewad 2 , Mesrak Nadew 2 , Petros Faltamo 3 and Jean Anderson 1,4 Address: 1 Jhpiego, an affiliate of Johns...

Ngày tải lên: 18/06/2014, 17:20

Ngày tải lên: 20/06/2014, 21:20

Ngày tải lên: 21/06/2014, 17:20

Ngày tải lên: 10/08/2014, 11:20

Ngày tải lên: 23/08/2014, 02:01

... characteristics of communication in the management of the management staff inseparable characteristics of the object management and process management. From the above communication management ... Characteristics of communication in management have peculiarities, valuable management emerged in the management, management object and management process. Basic characteristics of communication ... establish relationships with management objects, to deal with management tasks, to maintain management functions, management staff should have the psychological traits and communication ability...

Ngày tải lên: 13/05/2014, 15:15

... item scales, and parametric analysis of variance (ANOVA) for responses that were summed to create a factor. All analyses were conducted at a 95% level of certainty and allowing for a margin of error of ... ultimate score that each manager received for each of the seven factors was calcu- lated from the mean of the summed items for that varia- ble. This allows one to treat the data as interval data measuring ... Central Page 1 of 7 (page number not for citation purposes) Human Resources for Health Open Access Research Managerial competencies of hospital managers in South Africa: a survey of managers...

Ngày tải lên: 18/06/2014, 17:20

... point of departure for a discussion of issues relating to the performance benefits of experience, training, and innate ability and also as a summary of the research already completed in this area. ... to a substantial decrease in the number of unavailable aircraft, again particularly in the middle days of the measurement period. The results of this study are significant, despite being based ... of- Service Groups 8 Table 2.3. Mission Capable Rate and Marginal Products of Pay Grade Groups 9 Table 2.4. Mission Capable Rate and Marginal Products of Year -of- Service Groups 9 Table 2.5. Predicted...

Ngày tải lên: 17/02/2014, 22:20

... because of the absence of the catalytic subunit ISP (Table 1). Figure 3A shows that a band of approximately 500 kDa was also found in this mutant strain when the mitochondrial membranes were ana- lyzed ... deletion in Saccharomyces cerevisiae. Nucleic Acids Res 21 , 3329–3330. 45 Ito H, Fukuda Y, Murata K & Kimura A (1983) Transformation of intact yeast cells treated with alkali cations. J Bacteriol ... but also in other organisms, such as Neurospora crassa [13], mammals [11] and plants [14]. A higher-order organization of the respiratory chain complexes was first proposed for bacterial respiratory...

Ngày tải lên: 18/02/2014, 08:20

... proponents of software risk management, information about the impact of software risk management has been sparse and anecdotal. There are only a few empirical studies about the commonality and type of software ... identification of risks that are often organizationally sensitive. It demands more courage to air such risks if organizationally accepted risk management procedures are not available. Interestingly, managers ... resource usage and deadline effect. The other items loading to this factor are: evaluation of performance require- ments, managing project complexity, and estimation of hardware and software capabilities....

Ngày tải lên: 07/03/2014, 00:20

... Lipo-oligo- saccharide of Campylobacter lari type strain ATCC 35221. Structure of the liberated oligosaccharide and an associated extracellular polysaccharide. Carbohydr. Res. 279, 245–264. 1766 A. D. Cox et al.(Eur. ... revealed glucitol, galactitol, glucosaminitol and L -glycero- D -manno-heptitol in approximately equimolar ratios. Sugar analysis of the LPS-derived alditol acetates from the galE mutant of strain ... O-deacylated lipid A (Lipid A- OH) is as indicated. Lipid A- OH consists of two glucosamine residues each bearing an N-linked 3-OH C 14:0 fatty acid and a phosphate group. Variation in lipid A- OH...

Ngày tải lên: 08/03/2014, 02:20

... immunoprecipi- tated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager. (B) Quantification of data presented in panel (A) , after correction for translation ... a- helical core region as indicated. The leader peptidase cleavage site is depicted with an arrow. Table 1. Bacterial strains and plasmids used in this study. Ts, temperature sensitive. Cam r and Amp r , ... directed against SecA, indicating that it is a complex of the radiolabeled (G-10L)94PhoE and SecA (Fig. 4B, lane 1). In addition, cross-linking adducts of  220 kDa and  40 kDa were also immunoprecipitated from...

Ngày tải lên: 08/03/2014, 09:20

... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... 5Â-GGCGGATCCAAGCCAGTGGTTGTTAAT AC-3Â and 5Â-GCCTCGAGAATCAAGTGTCCCTGCACC T-3Â (LIN-54-DN); 5Â-GCGGATCCGAGGTGGTGCCAG CTGAG-3Â,5Â-GCTCTAGAGAATGGAAGCCGTGCCT G-3Â,5Â-GCTCTAGATTGGCAGATGCAGCTGAAGTA- 3Â and...

Ngày tải lên: 23/03/2014, 04:20

... plasmid. The gene was amplified from this plasmid by PCR using for- ward primer 5 Â-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3Â and reverse primer 5Â-ACT- TATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3Â. ... cDNA for cB using forward primer 5Â-ACTTATACTACT CATATGGGGAAGATCACTTTTT ACG-3Â and reverse primer 5Â-ACTTATACTATC CTCG AGATAAAAATCCATCACCCG-3Â, and digested this with restriction enzymes NdeI and ... chromatography was performed on a SMART chromatographic workstation (Pharmacia, GE Healthcare Biosciences AB, Uppsala, Sweden), using an analytical Superdex-200 column (Pharmacia) (bed volume approximately...

Ngày tải lên: 23/03/2014, 04:21

... uses a large-vocabulary tagger (Ratnaparkhi, 1996) as a preprocessing stage may compensate for its smaller vocabu- lary. Also, the main reason for using a smaller vocabulary is the computational ... Empirical Methods in Natural Language Processing, pages 133–142, Univ. of Pennsylvania, PA. Adwait Ratnaparkhi. 1999. Learning to parse natural language with maximum entropy models. Machine Learning, ... on Empirical Methods in Natural Language Pro- cessing, pages 9–16, Univ. of Pennsylvania, PA. Peter Lane and James Henderson. 2001. In- cremental syntactic parsing of natural lan- guage corpora with...

Ngày tải lên: 23/03/2014, 19:20

... management in sub-Saharan Africa: How much palliative care is needed?. AIDS Care 2007, 19(10):1304-1306. 13. Namisango E, Katabira E, Karamagi C, Baguma P: Validation of the Missoula-Vitas Quality -of- Life ... RESEARC H Open Access Validation of a core outcome measure for palliative care in Africa: the APCA African Palliative Outcome Scale Richard Harding 1* , Lucy Selman 1 , Godfrey Agupio 2 , Natalya ... Hospice Africa Uganda and the Hospice Palliative Care Association of South Africa. The APCA African POS The APCA African POS contains 10 items, addressing the physical and psychological symptoms,...

Ngày tải lên: 18/06/2014, 19:20

Ngày tải lên: 19/06/2014, 08:20