core competencies of a brand manager

... mild-acid hydrolysis and an oligosaccharide mixture (OS HOAc ) w as isolated by gel-permeation chromatograp hy on Sephadex G-50. Sugar analysis of OS HOAc by GLC of the acetylated alditols revealed ... Y .A. & K rohn, K. (1996) Immunochemic al characterization of O polysaccharid es compo- sing the a- D -rhamnose backbone of lipopolysaccharide of Pseu- domonas s yringae and classification of ... Mild acid degradation of the LPS gave the major glycoform 1 c ore octasaccharide and a minor trun- cated glycoform 2 core heptasaccharide, which resulted from the cleavage of the terminal Kdo residues....

Ngày tải lên: 23/03/2014, 13:20

Ngày tải lên: 20/06/2014, 21:20

Ngày tải lên: 21/06/2014, 17:20

Ngày tải lên: 10/08/2014, 11:20

Ngày tải lên: 23/08/2014, 02:01

... item scales, and parametric analysis of variance (ANOVA) for responses that were summed to create a factor. All analyses were conducted at a 95% level of certainty and allowing for a margin of error of ... ultimate score that each manager received for each of the seven factors was calcu- lated from the mean of the summed items for that varia- ble. This allows one to treat the data as interval data measuring ... Central Page 1 of 7 (page number not for citation purposes) Human Resources for Health Open Access Research Managerial competencies of hospital managers in South Africa: a survey of managers...

Ngày tải lên: 18/06/2014, 17:20

... because of the absence of the catalytic subunit ISP (Table 1). Figure 3A shows that a band of approximately 500 kDa was also found in this mutant strain when the mitochondrial membranes were ana- lyzed ... deletion in Saccharomyces cerevisiae. Nucleic Acids Res 21 , 3329–3330. 45 Ito H, Fukuda Y, Murata K & Kimura A (1983) Transformation of intact yeast cells treated with alkali cations. J Bacteriol ... but also in other organisms, such as Neurospora crassa [13], mammals [11] and plants [14]. A higher-order organization of the respiratory chain complexes was first proposed for bacterial respiratory...

Ngày tải lên: 18/02/2014, 08:20

... proponents of software risk management, information about the impact of software risk management has been sparse and anecdotal. There are only a few empirical studies about the commonality and type of software ... identification of risks that are often organizationally sensitive. It demands more courage to air such risks if organizationally accepted risk management procedures are not available. Interestingly, managers ... resource usage and deadline effect. The other items loading to this factor are: evaluation of performance require- ments, managing project complexity, and estimation of hardware and software capabilities....

Ngày tải lên: 07/03/2014, 00:20

... Lipo-oligo- saccharide of Campylobacter lari type strain ATCC 35221. Structure of the liberated oligosaccharide and an associated extracellular polysaccharide. Carbohydr. Res. 279, 245–264. 1766 A. D. Cox et al.(Eur. ... revealed glucitol, galactitol, glucosaminitol and L -glycero- D -manno-heptitol in approximately equimolar ratios. Sugar analysis of the LPS-derived alditol acetates from the galE mutant of strain ... O-deacylated lipid A (Lipid A- OH) is as indicated. Lipid A- OH consists of two glucosamine residues each bearing an N-linked 3-OH C 14:0 fatty acid and a phosphate group. Variation in lipid A- OH...

Ngày tải lên: 08/03/2014, 02:20

... immunoprecipi- tated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager. (B) Quantification of data presented in panel (A) , after correction for translation ... a- helical core region as indicated. The leader peptidase cleavage site is depicted with an arrow. Table 1. Bacterial strains and plasmids used in this study. Ts, temperature sensitive. Cam r and Amp r , ... directed against SecA, indicating that it is a complex of the radiolabeled (G-10L)94PhoE and SecA (Fig. 4B, lane 1). In addition, cross-linking adducts of  220 kDa and  40 kDa were also immunoprecipitated from...

Ngày tải lên: 08/03/2014, 09:20

... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... 5Â-GGCGGATCCAAGCCAGTGGTTGTTAAT AC-3Â and 5Â-GCCTCGAGAATCAAGTGTCCCTGCACC T-3Â (LIN-54-DN); 5Â-GCGGATCCGAGGTGGTGCCAG CTGAG-3Â,5Â-GCTCTAGAGAATGGAAGCCGTGCCT G-3Â,5Â-GCTCTAGATTGGCAGATGCAGCTGAAGTA- 3Â and...

Ngày tải lên: 23/03/2014, 04:20

... plasmid. The gene was amplified from this plasmid by PCR using for- ward primer 5 Â-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3Â and reverse primer 5Â-ACT- TATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3Â. ... cDNA for cB using forward primer 5Â-ACTTATACTACT CATATGGGGAAGATCACTTTTT ACG-3Â and reverse primer 5Â-ACTTATACTATC CTCG AGATAAAAATCCATCACCCG-3Â, and digested this with restriction enzymes NdeI and ... chromatography was performed on a SMART chromatographic workstation (Pharmacia, GE Healthcare Biosciences AB, Uppsala, Sweden), using an analytical Superdex-200 column (Pharmacia) (bed volume approximately...

Ngày tải lên: 23/03/2014, 04:21

Ngày tải lên: 18/06/2014, 19:20

Ngày tải lên: 11/08/2014, 18:20

Ngày tải lên: 13/08/2014, 16:20

Ngày tải lên: 13/08/2014, 20:22

Ngày tải lên: 14/08/2014, 08:20

Ngày tải lên: 04/11/2014, 10:55

... log as the most up to date ‘‘truth’’ about the state of the data on disk. The main difference is that database systems do not use the log as the final repository for data: a separate data area is ... purpose. The separate data area of these database systems means that they do not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space. The space occupied by the log in a database system ... The bandwidth of each of the five phases is shown separately. Sprite LFS has a higher write bandwidth and the same read bandwidth as SunOS with the exception of sequen- tial reading of a file that...

Ngày tải lên: 12/09/2012, 15:05

... in nature to a data manager which fails to free data, but is easier to detect and prevent. ã Data manager changes data. A malicious data manager may change the value of its data on each cache refresh. ... that must be prevented. For example, a data manager may wish to temporarily allow read-only access to cached data. The locking on a page may later be changed as deemed necessary by the data manager. ... data. It is usually made in response to a pager_data_request call made to the data manager by the kernel. Typical data managers will only provide data upon demand (when processing pager_data_request...

Ngày tải lên: 12/09/2012, 15:05