... mild-acid hydrolysis and an oligosaccharide mixture (OS HOAc ) w as isolated by gel-permeation chromatograp hy on Sephadex G-50. Sugar analysis of OS HOAc by GLC of the acetylated alditols revealed ... Y .A. & K rohn, K. (1996) Immunochemic al characterization of O polysaccharid es compo- sing the a- D -rhamnose backbone of lipopolysaccharide of Pseu- domonas s yringae and classification of ... Mild acid degradation of the LPS gave the major glycoform 1 c ore octasaccharide and a minor trun- cated glycoform 2 core heptasaccharide, which resulted from the cleavage of the terminal Kdo residues....
Ngày tải lên: 23/03/2014, 13:20
Ngày tải lên: 20/06/2014, 21:20
báo cáo hóa học:" Metabolite proving fungal cleavage of the aromatic core part of a fluoroquinolone antibiotic" docx
Ngày tải lên: 21/06/2014, 17:20
managerial competencies of middle-level managers at viglacera corporation
Ngày tải lên: 23/08/2014, 02:01
báo cáo sinh học:" Managerial competencies of hospital managers in South Africa: a survey of managers in the public and private sectors" docx
... item scales, and parametric analysis of variance (ANOVA) for responses that were summed to create a factor. All analyses were conducted at a 95% level of certainty and allowing for a margin of error of ... ultimate score that each manager received for each of the seven factors was calcu- lated from the mean of the summed items for that varia- ble. This allows one to treat the data as interval data measuring ... Central Page 1 of 7 (page number not for citation purposes) Human Resources for Health Open Access Research Managerial competencies of hospital managers in South Africa: a survey of managers...
Ngày tải lên: 18/06/2014, 17:20
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... because of the absence of the catalytic subunit ISP (Table 1). Figure 3A shows that a band of approximately 500 kDa was also found in this mutant strain when the mitochondrial membranes were ana- lyzed ... deletion in Saccharomyces cerevisiae. Nucleic Acids Res 21 , 3329–3330. 45 Ito H, Fukuda Y, Murata K & Kimura A (1983) Transformation of intact yeast cells treated with alkali cations. J Bacteriol ... but also in other organisms, such as Neurospora crassa [13], mammals [11] and plants [14]. A higher-order organization of the respiratory chain complexes was first proposed for bacterial respiratory...
Ngày tải lên: 18/02/2014, 08:20
Components of Software Development Risk: How to Address Them? A Project Manager Survey ppt
... proponents of software risk management, information about the impact of software risk management has been sparse and anecdotal. There are only a few empirical studies about the commonality and type of software ... identification of risks that are often organizationally sensitive. It demands more courage to air such risks if organizationally accepted risk management procedures are not available. Interestingly, managers ... resource usage and deadline effect. The other items loading to this factor are: evaluation of performance require- ments, managing project complexity, and estimation of hardware and software capabilities....
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx
... Lipo-oligo- saccharide of Campylobacter lari type strain ATCC 35221. Structure of the liberated oligosaccharide and an associated extracellular polysaccharide. Carbohydr. Res. 279, 245–264. 1766 A. D. Cox et al.(Eur. ... revealed glucitol, galactitol, glucosaminitol and L -glycero- D -manno-heptitol in approximately equimolar ratios. Sugar analysis of the LPS-derived alditol acetates from the galE mutant of strain ... O-deacylated lipid A (Lipid A- OH) is as indicated. Lipid A- OH consists of two glucosamine residues each bearing an N-linked 3-OH C 14:0 fatty acid and a phosphate group. Variation in lipid A- OH...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
... immunoprecipi- tated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager. (B) Quantification of data presented in panel (A) , after correction for translation ... a- helical core region as indicated. The leader peptidase cleavage site is depicted with an arrow. Table 1. Bacterial strains and plasmids used in this study. Ts, temperature sensitive. Cam r and Amp r , ... directed against SecA, indicating that it is a complex of the radiolabeled (G-10L)94PhoE and SecA (Fig. 4B, lane 1). In addition, cross-linking adducts of 220 kDa and 40 kDa were also immunoprecipitated from...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt
... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... 5Â-GGCGGATCCAAGCCAGTGGTTGTTAAT AC-3Â and 5Â-GCCTCGAGAATCAAGTGTCCCTGCACC T-3Â (LIN-54-DN); 5Â-GCGGATCCGAGGTGGTGCCAG CTGAG-3Â,5Â-GCTCTAGAGAATGGAAGCCGTGCCT G-3Â,5Â-GCTCTAGATTGGCAGATGCAGCTGAAGTA- 3Â and...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... plasmid. The gene was amplified from this plasmid by PCR using for- ward primer 5 Â-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3Â and reverse primer 5Â-ACT- TATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3Â. ... cDNA for cB using forward primer 5Â-ACTTATACTACT CATATGGGGAAGATCACTTTTT ACG-3Â and reverse primer 5Â-ACTTATACTATC CTCG AGATAAAAATCCATCACCCG-3Â, and digested this with restriction enzymes NdeI and ... chromatography was performed on a SMART chromatographic workstation (Pharmacia, GE Healthcare Biosciences AB, Uppsala, Sweden), using an analytical Superdex-200 column (Pharmacia) (bed volume approximately...
Ngày tải lên: 23/03/2014, 04:21
báo cáo hóa học: " Validation of a core outcome measure for palliative care in Africa: the APCA African Palliative Outcome Scale" pptx
Ngày tải lên: 18/06/2014, 19:20
báo cáo khoa học: " Retailers’ knowledge of tobacco harm reduction following the introduction of a new brand of smokeless tobacco" pps
Ngày tải lên: 11/08/2014, 18:20
Báo cáo y học: ": Combined analysis reveals a core set of cycling genes" pdf
Ngày tải lên: 14/08/2014, 08:20
diary of a very bad year - anonymous hedge fund manager, n
Ngày tải lên: 04/11/2014, 10:55
The Design and Implementation of a Log-Structured File System
... log as the most up to date ‘‘truth’’ about the state of the data on disk. The main difference is that database systems do not use the log as the final repository for data: a separate data area is ... purpose. The separate data area of these database systems means that they do not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space. The space occupied by the log in a database system ... The bandwidth of each of the five phases is shown separately. Sprite LFS has a higher write bandwidth and the same read bandwidth as SunOS with the exception of sequen- tial reading of a file that...
Ngày tải lên: 12/09/2012, 15:05
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... in nature to a data manager which fails to free data, but is easier to detect and prevent. ã Data manager changes data. A malicious data manager may change the value of its data on each cache refresh. ... that must be prevented. For example, a data manager may wish to temporarily allow read-only access to cached data. The locking on a page may later be changed as deemed necessary by the data manager. ... data. It is usually made in response to a pager_data_request call made to the data manager by the kernel. Typical data managers will only provide data upon demand (when processing pager_data_request...
Ngày tải lên: 12/09/2012, 15:05