... Complying with ASME B31 codes for the Level earthquake negates the need to consider the Level earthquake • Alternate acceptance criteria are justified in cases where typical B31 code criteria can not ... codes • ASME code requirements for piping are based upon static loading considerations and equivalent static approaches for assessing dynamic piping stresses are considered adequate – Modal analyses ... ASME B31.4 is not compatible with performance-based MOTEMS criteria and is most applicable to design for the Level earthquake • The adoption of ASME B31.E provides a better approach for the Level...
Ngày tải lên: 31/07/2014, 23:21
... Read all rows from the DataReader while(dr.Read( )) { // Read the row from the DataReader into an array dr.GetValues(aData); // Add the row from the array to the DataTable dataTable.Rows.Add(aData); ... key to the table dataTable.PrimaryKey = (DataColumn[])pkCols.ToArray(typeof(DataColumn)); // Add the table to the DataSet ds.Tables.Add(dataTable); object[] aData = new object[dataTable.Columns.Count]; ... ); if (schemaTable != null) { ArrayList pkCols = new ArrayList( ); DataTable dataTable = new DataTable( ); foreach(DataRow schemaRow in schemaTable.Rows) { DataColumn col = new DataColumn( );...
Ngày tải lên: 07/11/2013, 13:15
Guide to electric power generation 3rd ed a pansini, k smalling (CRC, 2006) WW
... between a base load unit or a peaking unit Most steam stations are base load units—that is they are on line at full capacity or near full capacity almost all of the time Steam stations, particularly ... control, and recreation facilities In times of maximum water availability, hydro plants may carry the base load of a system to save fuel costs while steam units are used to carry peak load variations ... small units known as Distributed Generation and by cogeneration rather than by the installation of large centrally located generating plants Although this may appear to be a throwback to earlier...
Ngày tải lên: 03/01/2014, 22:44
Tài liệu How to build a Multi-Level Money Machine docx
... what a realistic average volume should be A small distributor who mainly retails may not always break away, yet, breakaway qualifications must be achievable with a fair amount of effort by a ... to be a pyramid infinite variations of legal and illegal marketing programs For that reason, multiOnly a few sophisticated states have level and anti-pyramid laws are drafted and statutes that ... ILLUSTRATION FIVE YOU Like the Breakaway plan, the Binary plans can be designed as top heavy plans to reward the company and a few top distributorships MARY MARY Because most Binaries pay weekly and...
Ngày tải lên: 24/01/2014, 07:20
Tài liệu A Power to Do Justice pdf
... particular was doing: thanks to Lauren Berlant, Elaine Hadley, Patchen Markell, Mark Miller, and Candace Vogler At an earlier date, Candace read the whole manuscript and offered a sustaining account ... and historical particular xii Acknowledgments adequate to my argument about literature’s place at the legal table, and law’s place at the literary one I feel fortunate to have been able to complete ... fictions analyzed in this book look to legal vocabularies pertaining to rather different areas of law (including land law, family law, ecclesiastical law, constitutional law, and early international...
Ngày tải lên: 18/02/2014, 13:20
Báo cáo hóa học: " Peak-to-Average-Power-Ratio (PAPR) reduction in WiMAX and OFDM/A systems" docx
... this article as: Khademi et al.: Peak -to- Average -Power- Ratio (PAPR) reduction in WiMAX and OFDM /A systems EURASIP Journal on Advances in Signal Processing 2011 2011:38 Submit your manuscript to a ... communication standards such as WiMAX These advantages makes it a very attractive technique to reduce PAPR The dedicated pilot feature is designed for beamforming and the standard explicitly states ... dedicated pilots Although there are now multiple streams, the basestation has to transmit pilots beamformed in the same way as the data Hence, the same technique as outlined above can be applied...
Ngày tải lên: 21/06/2014, 01:20
Báo cáo y học: " Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments" pps
... teleconference All authors read and approved the final manuscript Additional material Additional file Candidate factors by change stages Table lists 33 candidate factors by organizational change stages that ... implementation Capacity to manage change Mean Change stage one: organizational goals & architecture Please tell us to what extent your organizational leadership and/or organizational staff are concerned ... provides a model of change implementation in healthcare organizations, informed by the implementation of a major patient safety initiative at a large, multisite, academic hospital in Toronto, Canada...
Ngày tải lên: 11/08/2014, 05:21
báo cáo khoa học: " Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments" doc
... teleconference All authors read and approved the final manuscript Additional material Additional file Candidate factors by change stages Table lists 33 candidate factors by organizational change stages that ... implementation Capacity to manage change Mean Change stage one: organizational goals & architecture Please tell us to what extent your organizational leadership and/or organizational staff are concerned ... provides a model of change implementation in healthcare organizations, informed by the implementation of a major patient safety initiative at a large, multisite, academic hospital in Toronto, Canada...
Ngày tải lên: 11/08/2014, 16:20
Báo cáo y học: "Bispectral index versus COMFORT score to determine the level of sedation in paediatric intensive care unit patients: a prospective study" docx
... ordinal scaling level The χ2 and Fisher's exact tests were used to analyze categorical data and Mann–Whitney Utest for data on at least ordinal level Data analysis was performed using SPSS statistical ... automatically matches certain EEG patterns to clinical states that are found in adult volunteers under sedation or anaesthesia In contrast, clinical scores are used to summarize the investigator's ... ventilation) and exclusion criteria (brain trauma, any kind of end-stage disease, use of muscle relaxants or persistent postoperative relaxation according to train-of-four monitoring, intractable agitation)...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps
... Vif was amplified using the forward primer YRHHYmutF, 5'GGAAAGCTAAGGACTGGT TTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATA AG3', and the reverse primer VifR, 5'GGATAAACAGCAGT TGTTGC3' The resulting amplicons ... proviral DNA, cRNA, and vRNA across each individual infection (YA, YB and YC) for Rounds and was determined Statistical significance was calculated using the t-test assuming equal variance with a ... 5'CAGGGAGATTCTAAAAG3', and the reverse primer YRHHYmutR, 5'CTTATTTTTGGATTAGTAC TTTCAGCGGCAGCTGCAGCAAACCAGTCCTTAGCTTTC C3', were used to amplify the N-terminal region of Vif The C-terminal portion of Vif was...
Ngày tải lên: 13/08/2014, 05:21
task 2 how to write at a 9 level
... What is a sentence? A sentence is a group of words What is a paragraph? A paragraph is a group of sentences What is an essay? An essay is a group of paragraphs Essays present an organized argument ... supporting paragraphs Chapter – Putting it all together 4.1 How to write a conclusion paragraph 4.2 Cohesion at the essay level Chapter – Discussion essays 5.1 How to analyze a topic in an ... introduction paragraph for an essay: Public transportation is a great way to travel, particularly within a metropolis Shanghai metro is the most convenient way to get around the city The Do you agree...
Ngày tải lên: 26/09/2014, 04:06
AN1025 converting a 5 0v supply rail to a regulated 3 0v
... converter or a switched-capacitor circuit, are just as easy to use as LDOs Like an LDO, a charge pump requires an input and output capacitor and a feedback resistor divider network However, charge pumps ... PICDEM.net, PICLAB, PICtail, PowerCal, PowerInfo, PowerMate, PowerTool, Real ICE, rfLAB, rfPICDEM, Select Mode, Smart Serial, SmartTel, Total Endurance, UNI/O, WiperLock and Zena are trademarks of Microchip ... inductor, output capacitor and a recirculating diode During a switching cycle, the MOSFET, Q1, transitions between an ON state and an OFF state Assume the buck regulator is operating in steady-state...
Ngày tải lên: 11/01/2016, 16:36
IELTS writing task 2 : How to write at a 9 level
... word is a group of letters What is a sentence? A sentence is a group of words What is a paragraph? A paragraph is a group of sentences What is an essay? An essay is a group of paragraphs Essays present ... Here we have an essay with an introduction paragraph and conclusion paragraph but no supporting paragraphs Read the essay question and write the missing paragraphs In achieving personal happiness, ... this is a phrase used in English to make it clear that a topic’s characteristics match the characteristics of a topic presented before it In our intro paragraph above, we are saying that technology...
Ngày tải lên: 05/06/2016, 16:27
Seven.Steps.To.A.Successfull.Business.Plan.pdf
... usually an ad campaign or program to catch public attention There is nothing wrong with that approach except that it is usually just that—an annual advertising campaign and not the actual story ... Plan and the Operational Plan 213 Analysis of Company Performance 214 Analysis of Competition 215 Analysis of Market and Market Share 216 Analysis of Mission 217 Analysis of Resources 218 Analysis ... performance that must be tracked against the business plan They are organizational, team, and individual All lead to the strategic goals Figure 12-4 During the sustaining phase you must pay attention...
Ngày tải lên: 21/09/2012, 17:33
The chart below shows the sleep patterns of people in five different occupations according to a Canadian study
... wake at a. m., but nap for two hours or so in the early afternoon Thus the influence on one's sleep pattern is worthy of consideration when choosing an occupation ...
Ngày tải lên: 04/10/2012, 10:02
Phân tích các yếu tố ảnh hưởng đến động lực làm việc của nhân viên công ty cổ phần du lịch an giang
... lý bán vé tàu Phú Quốc, bán vé máy bay - Sản xuất và kinh doanh hàng nông sản và thủy sản - Mua bán xe gắn máy bánh, phương tiện vận tải • Nhà hàng, khách sạn, khu du ... đóng gói bao bì nông sản, mua bán nông sản Nhà máy chế biến nông sản xuất khẩu I: xay xát thóc lu a, a nh bóng gạo; mua bán lương thực; đóng gói lu a gạo Nhà máy chế biến ... nông sản xuất khẩu V: xay xát thóc lu a, a nh bóng gạo; mua bán lương thực; đóng gói lu a gạo Nhà máy chế biến gạo xuất khẩu Định Thành: xay xát thóc lu a, a nh bóng gạo;...
Ngày tải lên: 29/11/2012, 08:58