converters data binding and datacontext into a custom datatemplate
![microsoft silverlight 5 data and services cookbook [electronic resource] over 100 practical recipes for creating rich, data-driven, business applications in silverlight 5](https://media.store123doc.com/images/document/14/y/ev/medium_neP7R4h80c.jpg)
microsoft silverlight 5 data and services cookbook [electronic resource] over 100 practical recipes for creating rich, data-driven, business applications in silverlight 5
Ngày tải lên :
29/05/2014, 17:28
... Local Data 175 Introduction Displaying data in a customized DataGrid Inserting, updating, and deleting data in a DataGrid Sorting and grouping data in a DataGrid Filtering and paging data in a DataGrid ... methods Validating data: using data annotations Validating data: writing a custom validator Validating data: server-side validation with client-side feedback Validating data: triggering validation ... at the more advanced concepts of data binding Chapter 3, Advanced Data Binding, teaches you advanced data binding concepts that can be used for customization, validations, and applying templates...
- 662
- 577
- 0
Báo cáo hóa học: " Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses" pdf
Ngày tải lên :
20/06/2014, 01:20
... reverse primers (Ts1: 5' CGTCTCAGTGATCCGGGGG 3', Ts2: 5'CGCCACAAGGGCCATGAACAG 3', Ts3: 5' TAACATCATCATGAGACAGAGC 3' and Ts4: 5'TGTTGTCTTAAACAAGAGAGGTC3'), as reported earlier [6] Single-step Dengue ... (D1: 5' TCAATATGCTAAAACGCGCGAGAAACCG 3' and D2: 5' TTGCACCAACAGTCAATGTCTTCAGGTTC 3') Dengue Nested PCR The nested PCR assay was performed according to the protocol [6] with slight modifications ... feasibility of the assay for clinical diagnosis was validated by evaluating with serum samples from 620 acutephase suspected patients and 40 healthy individuals from the same area On comparative...
- 5
- 482
- 0
springer-verlag investment banking a guide to underwriting and advisory services
Ngày tải lên :
04/11/2014, 04:21
... organized into sequential rounds and usually take a minority stake The organizational form (limited partnership), the agreement between LPs and GPs and the way performance is measured are equal ... is a clear drop both in the number and the value of the transactions: in particular, the drop in the value is due in part to a decreased number of deals and in part to a crash in financial markets ... AMRO Macquarie Bank Greenhill & Co, LLC Societe Generale Banc of America Securities LLC Gresham Partners RBC Capital Markets Santander Global Banking Royal Bank of Scotland Group CIBC World Markets...
- 196
- 642
- 1
Talking to lewis and clark
Ngày tải lên :
03/10/2015, 21:42
... say about Lewis and Clark’s group Extend Language Sacajawea translated the Hidatsa into Shoshone Hidatsa and Shoshone Shoshone and Salish A Shoshone boy (who lived among the Salish people) translated ... English and French French and Hidatsa Toussaint Charbonneau translated the French into Hidatsa Talk About It Why was it difficult for Lewis and Clark to communicate with many of the Native Americans ... place where a river begins The Shoshone people helped guide Lewis and Clark over the Rocky Mountains Later, Charbonneau and Sacajawea helped Lewis and Clark talk to the Salish Native Americans,...
- 6
- 146
- 0
LoopStar® 700 Ethernet and TDM Services Over Fiber to Multiple Customers and Locations
Ngày tải lên :
18/10/2013, 19:15
... requiring a separate (out-of-band) overlay management network Because all equipment is owned by the carrier, multiple points of demarcation can be established and dynamically tailored as real time ... physically changing the interface Streamlined management and provisioning Because a single, universal platform supports packet and TDM services – both in the PoP and throughout in-building and campus ... per-VLAN basis, allows the carrier to carefully define how bandwidth is allocated on that shared platform In the campus or high-rise POP, a single LoopStar 700 platform can aggregate traffic...
- 4
- 350
- 0
The Six Driving Forces That Affect Your Business Plan _ And How to Focus on the Best One for Your Company’s Needs
Ngày tải lên :
24/10/2013, 09:20
... is only one Randall Training development companies such as the American Management Association (AMA) or its Canadian counterpart, the excellent Canadian Management Centre (CMC), are also productsdriven ... concept of a single focus to create alignment and contribute to high performance Many types of organizations such as London Guarantee Insurance Company, Ontario Northland, and Alcan Cable’s Rod and ... War and movies made big, obscene knives popular, many knife makers got into the act, creating absurd designs more for fantasy than reality During this time Randall never wavered Year after year...
- 28
- 825
- 0
Tài liệu LoopStar® 711 Leveraging a Full Suite of Ethernet and TDM Services to Cost-Effectively Utilize Fiber Networks doc
Ngày tải lên :
10/12/2013, 19:15
... *Includes: AC power supply and AC power cord, blanking plate, 19” and 23” rack mount brackets, console cable, license for basic software and documentation LPS-711-48DC L1 SPEC SHEET LPS-711-48VDC Package ... Specifications Data Interfaces • x 10/100Base-T • x 10/100Base-T • x T1/E1/J1 for circuit emulation • x 100FX (SFP) • CLI management interfaces - RS-232 - 10/100 • In-band or out-of-band • SNMP ... supply (OPM4812), 19” and 23” rack mount brackets, console cable, license for basic software and documentation LPS-711-AC L1 Web Site: www.adc.com From North America, Call Toll Free: 1-800-366-3891...
- 4
- 405
- 0
Tài liệu To establish an Office on Women’s Health within the Department of Health and Human Services, and for other purposes pdf
Ngày tải lên :
13/02/2014, 07:20
... grants to, and enter into cooperative agree- 15 ments, contracts, and interagency agreements with 16 public and nonprofit private entities, agencies, and 17 organizations 18 ‘‘(2) EVALUATION AND ... prevention pro- grams, public and professional education, services, and treatment; ‘‘(2) establish short-range and long-range goals and objectives for women’s health and coordinate all other activities ... findings made under 20 subparagraphs (A) and (B) 21 ‘‘(d) REPORTS.—Not later than January 31, 2003, 22 and January 31 of each second year thereafter, the Direc23 tor of the Office shall prepare and...
- 18
- 644
- 0
Tài liệu To improve the health of women through the establishment of Offices of Women’s Health within the Department of Health and Human Services pdf
Ngày tải lên :
13/02/2014, 07:20
... Department of Health and Human Services’ offices, agencies, and regional ac- tivities regarding women’s health and stimulate ac- tivities and facilitate coordination of such depart- mental and agency ... the health concerns of women, shall— 16 ‘‘(1) establish short-range and long-range goals 17 and objectives within the Department of Health and 18 Human Services and, as relevant and appropriate, ... to, and enter 16 into cooperative agreements, contracts, and inter- 17 agency agreements with, public and private entities, 18 agencies, and organizations 19 ‘‘(2) EVALUATION AND DISSEMINATION.—The...
- 23
- 627
- 0
Tài liệu The 2011 Report to the Secretary:Rural Health and Human Services Issues docx
Ngày tải lên :
18/02/2014, 15:20
... (U.S Department of Health and Human Services, Health Resources and Services Administration), http:// www.hrsa.gov /data- statistics/health-center -data/ NationalData/2009/2009 nattotsumdata.html 34 ... (Northern Mariana, American Samoa, Guam, Puerto Rico, and the Virgin Islands) Challenges and Opportunities The Committee commends the Administration and ACF for moving toward a place-based approach ... providers that are ready to work on forming an ACO and that the cap is lifted so that HRSA can make larger and more targeted awards to support those small rural hospitals ready to take part in ACOs...
- 38
- 835
- 0
To establish an Office on Women’s Health within the Department of Health and Human Services, and for other purposes ppt
Ngày tải lên :
14/03/2014, 14:20
... the health concerns of women, shall— 20 ‘‘(1) establish short-range and long-range goals 21 and objectives within the Department of Health and 22 Human Services and, as relevant and appropriate, ... 16 relevant and appropriate, adequate inclusion of 17 women and analysis of data by sex in Administration 18 protocols and policies; 19 ‘‘(3) provide information to women and health 20 care providers ... participation in clinical trials and the analysis of data by sex in the testing of drugs, medical devices, and biological 10 products across, where appropriate, age, biological, 11 and sociocultural...
- 22
- 419
- 0
Policy Opportunities and Constraints to Access Youth Financial Services ppt
Ngày tải lên :
15/03/2014, 09:20
... from Latin America and the Caribbean, 21 percent are from Asia, 11 percent are from the Middle East and North Africa, 10 percent are from Europe, and two percent are from Australia and Oceania The ... schools and markets, or in other areas that are far from the branches (e.g PAMECAS in Senegal, Finance Trust in Uganda) FINCA Uganda may also operate ‘light’ branches, which have fewer staff, one ... youth financial and non-financial services and monitoring and evaluation As a result UNCDF-YouthStart in partnership with MicroSave, Reach Global and Population Council, delivered a 10-day training...
- 32
- 321
- 0
Strategic thinking: A nine step approach to strategy and leadership for managers and marketers
Ngày tải lên :
15/03/2014, 15:33
... organizations, and by managers of large multinational companies and international NGOs It is popular with final-year undergraduates and MBA and Master's students of business, management and marketing ... the marketing team Total immersion encouraged a rapid growth of market and technical expertise and this favoured commercially patentable innovation (Step of The 9S©Approach) Bureaucracy and administrative ... institutions, democracy, hierarchies and ways of thinking that have largely proved to be accurate This was because he had knowledge about changes that had already taken place at the time he made his predictions...
- 159
- 1.2K
- 0
Universal access to sexual and reproductive health services pptx
Ngày tải lên :
22/03/2014, 12:20
... involvement at all stages of the policy-making process; and government provision of accessible and equitable healthcare [Summary adapted from Siyanda www.siyanda.org] Available online at: http://www.bridge.ids.ac.uk/reports/BB18_HIV.pdf ... services, health services near villages, income generation opportunities, and improved nutrition [Summary adapted from Siyanda www.siyanda.org] Available online at: www.siyanda.org/search/summary.cfm?nn=2713&ST=SS&Keywords=access%20to%20care%2 ... social, political, cultural, and health factors that shape reproduction and sexuality The paper concludes that to achieve real impact, a comprehensive approach that improves access to services and...
- 24
- 781
- 0
The impact of and responses to HIV/AIDS in the private security and legal services industry in South Africa potx
Ngày tải lên :
22/03/2014, 18:20
... HIV/AIDS Section Social Aspects of HIV/AIDS and Health Research Programme x Yoesrie Toefy, MA Database Manager (Doctoral Research Trainee) Social Aspects of HIV/AIDS Research Alliance (SAHARA) ... testing strategy A1 A1 – A1 + Negative 10% A2 A2 A1 +A2 + Positive A1 +A2 – A1 A2 + A1 A2 – Negative A3 A3 + Positive A3 – Negative A 1, 2, + – = Assay = Order of assays = Reactive = Non-reactive 17 All specimens ... Trainee) Behavioural and Social Aspects of HIV/AIDS Section Social Aspects of HIV/AIDS and Health Research Programme Yolande Shean Project Administrator Behavioural and Social Aspects of HIV/AIDS Section...
- 192
- 478
- 0
Báo cáo khoa học: "Prognostic significance of IDH-1 and MGMT in patients with glioblastoma: One step forward, and one step back" pot
Ngày tải lên :
09/08/2014, 09:21
... SR, WW and JD treated the patients and collected the cllinical data SC and JD performed the clinical analysis of the dataset CH and AvD performed the histopathological and molecular analysis ... fractions was applied All patients were treated with concomitant TMZ, and adjuvant TMZ was given in 34 patients At this time, a phase II trial evaluation radiation and chemotherapy with TMZ at a dose ... and AA analyszed the prognostic relevance of the molecular data SC and CH wrote the mansucript JD, AvD, WW, SR and AA helped with manuscript finalization and discussion Reference List Pegg AE...
- 18
- 365
- 0
Báo cáo y học: "Health system weaknesses constrain access to PMTCT and maternal HIV services in South Africa: a qualitative enquiry" pptx
Ngày tải lên :
10/08/2014, 05:22
... namely: an academic hospital in Johannesburg, Gauteng; and in the Eastern Cape, an academic hospital, a regional hospital and a primary health care clinic The Eastern Cape facilities only began ... HIV and AIDS care, management and treatment for South Africa Pretoria, South African Dept of Health; 2003 World Health Organization: Antiretroviral therapy for HIV infection in adults and adolescents: ... to navigate the myriad challenges they face and address their mental health, including maternal and postnatal depression and other anxiety and stress-related disorders On-site support groups and...
- 9
- 404
- 0
báo cáo khoa học: " User’s perspectives of barriers and facilitators to implementing quality colonoscopy services in Canada: a study protocol" pps
Ngày tải lên :
10/08/2014, 10:23
... Canada 5Department of Medicine, Université Laval, Québec, Canada 6Canadian Partnership Against Cancer, Québec, Canada 7University of Calgary, Calgary, Alberta, Canada Authors’ contributions All authors ... outcomes Screening and data abstraction All titles and abstracts will be screened independently by a team consisting of one of the two principal investigators and a research associate to assess fitness ... contexts in Canada As such, 10 to 18 participants [68] for each group of users will be recruited across Canada through professional associations and corporations, regional health authorities, and experts...
- 9
- 337
- 0
báo cáo khoa học: " Patient- and delivery-level factors related to acceptance of HIV counseling and testing services among tuberculosis patients in South Africa: a qualitative study with " pdf
Ngày tải lên :
10/08/2014, 10:23
... automatically have HIV, and they not want to know They are afraid of the fact that HIV is not curable So when they have TB they are afraid to go and test and hear bad news Another prominent barrier ... patient acceptance and participation rates but also for the adoption, implementation, and sustainability of such programs by healthcare teams, including community health workers and program managers ... Appreciation is also extended to Centre for Health Systems Research & Development colleagues, Nomfazwe Thomas, Palesa Tladi, and Anja Pienaar for their contributions to the data gathering and analysis...
- 10
- 407
- 0