convert a result set to an array of data

... Universiti Kebangsaan Malaysia and Ministry of Higher Education of Malaysia under research grant UKM-GUPNBT-08-25-086 and UKM-RRR1-07-FRGS0037-2009 and the Universiti Tenaga Nasional and Ministry of Science ... 43600, Bangi, Selangor, Malaysia 2College of Engineering, Universiti Tenaga Nasional, 43000, Kajang, Selangor, Malaysia Department of Materials Chemistry, Graduate School of Engineering, Kyoto University, ... Kyoto 615-8520 Japan Authors’ contributions RT carried out nanostructure preparation and characterisation and drafted the manuscript AAU designed the concept and experiment, analysed the results...

Ngày tải lên: 20/06/2014, 22:20

... Object[][] tableArray = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and ... the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the names ... nRows = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array. CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection of rows...

Ngày tải lên: 26/01/2014, 10:20

Ngày tải lên: 04/11/2013, 10:15

... calculated as 82 It is unclear, but Fabiani et al (1996) and Fabiani et al (2000) appear to report the same participants Karwautz at al (2008) and Wagner et al (2008) report the same participants, ... bias? Use of valid and reliable paper and pencil measures a Sub-total Results Confounding variables controlled Generalisable results? Sub-total Total score Fabiani et al (1996) Fabiani et al (2000) ... years Can read and Not understand reported Dutch Aged -11 Outpatients and Austrian and German Coeliac Societies 283 (83%) first wave; 168 (59%; due to drop out of noneating pathology participants)...

Ngày tải lên: 12/02/2014, 12:20

... readily available in the MATLAB (MATrix LABoratory) programming language After some testing with various similarity functions and linkage types, we finally opted for the cosine coefficient and ... sense, have essentially been found According to our judgment, all words in the upper branch of the hierarchical tree are related to the hand sense of palm, and all other words are related to its ... our attention to the various species of animals that are among the top 30 associations to poach Some of them seem more often affected by cooking (pheasant, chicken, salmon), others by poaching...

Ngày tải lên: 20/02/2014, 16:20

... prepositio'~aT-~rase rather than as an adverbial phrase No attempt is made to show any paraphrase relationships Putative deleted or a 161 either close a previously opened adjective phrase and continue an already ... document: Department of English, University of Oslo Ku~era, H and Francis, W.N (196~, revised 1971 and 1979) Manual of Information to accompany A Standard Corpus of Present-Day Edited American E a R l ... of the T-tag look up procedure against samples of the corpus that have been manually parsed accordiug to the rules contained in the Case Law Manual ~here alternative T-tags are assigned for any...

Ngày tải lên: 22/02/2014, 09:20

... Administration National Aerospace Plane National Aeronautic Test Alliance Naval Air Systems Command National Full-Scale Aerodynamics Complex National Transonic Facility Office National d’Etudes et ... senior advisers and consultants to help analyze the data received and to augment the information based on their own expertise with various national and international facilities In addition, the analysis ... Command Arnold Engineering and Development Center Air Force Base Air Force Research Laboratory Air Force Office of Scientific Research American Institute of Aeronautics and Astronautics Aero and...

Ngày tải lên: 06/03/2014, 16:20

Ngày tải lên: 07/03/2014, 02:20

... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... used to amplify omcA (lane 2), omcB (lane 3), mtrA (lane 4) and mtrB (lane 5) in the omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was ... used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards are indicated at the left and right of the agarose gels (B) Visualization and separation of high molecular mass...

Ngày tải lên: 07/03/2014, 09:20

... they have two core concepts and a syntactic and semantic Human evaluation We next perform two human experiments to indirectly evaluate the quality of the automatically generated cue phrase variants ... non-interpolated Mean Average Precision (MAP), a standard measure for evaluating ranked information retrieval runs, which combines precision and recall and ranges from to 15 We use pairs of 2-tuples as ... syntactically complex goal-type and continuation-type cue phrases, and correctly rejected deceptive variants8 Syntactic variants and semantic filters The syntactic variant extractor takes as its...

Ngày tải lên: 08/03/2014, 02:21

... to restrict the number of rows to a vocabulary appropriate for evaluation purposes Since we are not aware of any standard vocabulary previously used in related work, we manually selected an ad ... sparseness can be minimized by reducing the dimensionality of the matrix An appropriate algebraic method that has the capability to reduce the dimensionality of a rectangular matrix is Singular Value ... purposes and to avoid problems with zero values We decided not to use a sophisticated association measure such as the log-likelihood ratio because it has an inappropriate value characteristic that...

Ngày tải lên: 08/03/2014, 04:22

... same Ala substitution was reported to cause a significant decrease in biological activities of [Ala8]NKA measured in human tissues [44] Indeed, [Ala8]NKA(4–10) was shown to be a weak partial agonist ... 9825–9832 Sachon, E., Girault-Lagrange, S., Chassaing, G., Lavielle, S & Sagan, S (2002) Analogs of Substance P modified at the C-terminus which are both agonist and antagonist of the NK-1 receptor depending ... varying /, w angles in intervals of 10° and setting h angle to ) 60 ± 10° and 60 ± 10° Each /, h, and w-value was fixed by applying a harmonic potential and the structures were minimized (adiabatic...

Ngày tải lên: 08/03/2014, 08:20

... executed; a comb, a necklet made of bird's claws inserted into one another, and several specimens of little bags, and a cap plaited out of sea-grass and almost water-tight In Cary's translation of Herodotus ... in attendance marches out into another room and partakes of a frugal Indian meal, generally composed of wild game; Chilé Colorado or red-pepper tortillas, and guayaves, with a good supply of ... custom! In the gorgeous landscapes and balmy climate of California an Indian incremation is as natural to the savage as it is for him to love the beauty of the sun Let the vile Esquimaux and...

Ngày tải lên: 08/03/2014, 13:20

... two: (1) i f additional information needs to be associated with a particular predicate, this can be done simply by adding another clause; and (2), Prolog provides a uniform way of representing ... use of FORTHand the Prolog formalism allowed f a i r ly easy development of the system even without the powerful structure manipulation capabilities of a language like LISP The major impact of ... sublanguage currently takes the form of an ATN grammar The parser takes a sentence as input and produces a parse tree The parse is input to the ERL "machine", which uses templates for the interpretation...

Ngày tải lên: 08/03/2014, 18:20

... ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example illustrates a number of instances of phonological ... early as ill-formed In Figure we give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra ... syllables are /pa/, /ngu/, /pa/, /ngu/ and /rnu/ (the sequences ng and rn represent single segments), that the feet are /pangu/ and /pangurnu/ and that there is a single prosodic word, namely/pangupangurnu/...

Ngày tải lên: 08/03/2014, 18:20

... Administration National Aerospace Plane National Aeronautic Test Alliance Naval Air Systems Command National Full-Scale Aerodynamics Complex National Transonic Facility Office National d’Etudes et ... senior advisers and consultants to help analyze the data received and to augment the information based on their own expertise with various national and international facilities In addition, the analysis ... Command Arnold Engineering and Development Center Air Force Base Air Force Research Laboratory Air Force Office of Scientific Research American Institute of Aeronautics and Astronautics Aero and...

Ngày tải lên: 15/03/2014, 18:20

... 20.6 The magical Lagrangian formalism The more symmetrical Hamiltonian picture Small oscillations Hamiltonian dynamics as symplectic geometry Lagrangian treatment of Welds How Lagrangians drive ... world of mathematics In particular, the above notion of an equivalence class is relevant not only to a great deal of important (but confusing) mathematics, but a great deal of important (and confusing) ... would regard mathematical objectivity as really what mathematical Platonism is all about To say that some mathematical assertion has a Platonic existence is merely to say that it is true in an objective...

Ngày tải lên: 17/03/2014, 14:53

Ngày tải lên: 23/03/2014, 05:22

... “palatable” neologisms generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat) These three suggestions are amusing and have a nice ... computational study in the literature that can be applied to the automatization of name generation Stock and Strapparava (2006) introduce an acronym ironic reanalyzer and generator called HAHAcronym ... available Kohli et al (2005) analyzed consumer evaluations of meaningful and nonmeaningful brand names and the results suggested that non-meaningful brand names are evaluated less favorably than...

Ngày tải lên: 23/03/2014, 14:20