... learning techniques. In EMNLP 2002, pages 79– 86. Patrick Pantel and Deepak Ravichandran. 2004. Au- tomatically labeling semantic classes. In NAACL- HLT’04, pages 321 – 328. Sunita Sarawagi and ... mining and sentiment analysis. Foundations and Trends in Infor- mation Retrieval, 2(1-2):1–135. Bo Pang, Lillian Lee, and Shivakumar Vaithyanathan. 2002. Thumbs up? sentiment classification using ma- chine ... reviews are sensitive to sentiment labels assigned to reviews in the source domain. Using a sparse matrix format and approximate similarity matching techniques (Sarawagi and Kirpal, 2004), we can...
Ngày tải lên: 20/02/2014, 04:20
... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 10482 10661 179 1G4P217 Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 81.8 ... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT DENV-2 98.9 ± 6.23 98.9 ± 6.23 2G2P5 GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC DENV-2 98.4 ± 0.84 98.4 ± 0.84 1G3P6 CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu COUNSELING and PSYCHOTHERAPY with ARABS and MUSLIMS A Culturally Sensitive Approach doc
... earth. “Wabtagi fema a tak Allah al-dar el-aakhera wala tansa nasibak men al-dunia” (Al-Qusas #77). [But seek, by means of that which God has given you, to attain the abode of the hereafter and ... and avoid hopelessness, by employing the verse, “Faasa an takrahou shaiaan wayajaalu Allah menhu khayran kathera” (Al-nisaa #19). [It may well be that you dislike a thing which God has meant ... katab Allah lana howa mawlana waala Allah falyatawakal el-moamenin” (Al-tawbah #51). [Say: Nothing will befall us except what God has ordained. He is our Guardian. In God let the faithful put...
Ngày tải lên: 15/02/2014, 15:20
Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf
... potentially involved (Riloff and Wiebe., 2003; Sarmento et al., 2009). Alternative approaches to automatic and manual construction of sentiment corpora have been pro- posed. For example, Kim and ... corpus annotations supports the annotation scheme proposed and helps to iden- tify directions for future work in this research area. 2 Related Work MPQA is an example of a manually annotated sentiment ... Natu- ral Language Processing and Computational Natural Language Learning, Prague. Krippendorff, Klaus. 2004. Content Analysis: An Intro- duction to Its Methodology, 2 nd Edition. Sage Publi- cations,...
Ngày tải lên: 20/02/2014, 05:20
Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf
... ex- presses negative valence and neutral arousal. After checking the posts, we have learned that it is be- cause the Japanese volcano Mount Asama has con- tinued to erupt. Some users are worried and discussed ... We also integrate the sentiment- detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format. Conceptually, ... generating music melody au- tomatically based on detected sentiments, and (3) produce an animation of real-time piano playing for audiovisual display. Our MemeTube system can be accessed via:...
Ngày tải lên: 20/02/2014, 05:20
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf
... GTCGGATC CGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp, GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢O SalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG. The deletion was constructed ... follows: era_F_NcoI, CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT. The resulting vector was termed pTrc9 9a: :era. Protein overexpression was assayed by SDS ⁄ PAGE. Selection ... to 60% at the same Mg 2+ concentrations. When the traces and the quantification of peak areas in JB69 and SQZ10 were examined, it appeared that there was a stoichoimetric imbalance of 30S and 50S...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo khoa học: "A Cost Sensitive Part-of-Speech Tagging: Differentiating Serious Errors from Minor Errors" pptx
... Conference on Com- putational Natural Language Learning. pp. 296–305. Taku Kudo, Kaoru Yamamoto, and Yuji Matsumoto. 2004. Applying Conditional Random Fields to Japanese Morphological Analysis. In Proceedings ... Linguis- tics. pp. 744–751. Joao Graca, Kuzman Ganchev, Ben Taskar, and Fernando Pereira. 2009. Posterior vs Parameter Sparsity in La- tent Variable Models. In Advances in Neural Informa- tion Processing ... 48–52. Drahom´ıra “johanka” Spoustov `a, Jan Hajiˇc, Jan Raab, and Miroslav Spousta 2009. Semi-supervised training for the averaged perceptron POS tagger. In Proceed- ings of the European Chapter...
Ngày tải lên: 07/03/2014, 18:20
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... the transcription initiation site a TATA- like sequence (TAAATA) is located between base pairs )28 and )23. A CCAAT-consensus box is located at )86 bp (CCAAT), a reverse CCAAT motif lies at )825 ... stranded oligonucleotides spanning the region from )70 to )36 of t he xMGP promoter (5¢-GATCCAGGGGAGGGAAAACAAGGA GATGAGGAGGTGTGGT-3¢,and5¢-GATCTACCA CACCTCCTCATCTCCTTGTTTTCCCTCCCCTG-3¢) as BamHI/BglII ... constructs )180/)36TATALUC and )180/)72TATALUC were gen- erated by PCR amplification with a common, sense oligonucleotide ( 5¢-CG GGATCCCAATCTGTTGCTAA TTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GA AGATCTACCACACCTCCTCATCTCC-3¢)...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: "A Sentiment Analyzer for Micro-blogs" potx
... Micro-blogs Aditya Joshi 1 Balamurali A R 2 Pushpak Bhattacharyya 1 Rajat Mohanty 3 1 Dept. of Computer Science and Engineering, IIT Bombay, Mumbai 2 IITB-Monash Research Academy, IIT Bombay, Mumbai 3 AOL ... Akshat Malu and Subhabrata Mukherjee, IIT Bombay for their assistance during generation of evalua- tion data. References Go Alec, Huang Lei, and Bhayani Richa. 200 9a. Twit- ter sentiment classification ... Analysis. MIT Press. Maite Taboada and Jack Grieve. 2004. Analyzing Ap- praisal Automatically. In Proceedings of the AAAI Spring Symposium on Exploring Attitude and Affect in Text: Theories and...
Ngày tải lên: 17/03/2014, 00:20
Báo cáo khoa học: "A Morphologically Sensitive Clustering Algorithm for Identifying Arabic Roots" docx
... semantically related pairs of words and document titles. Information Storage and Retrieval,. Vol 10, pp 253-260 Al-Fedaghi Sabah S. and Fawaz Al-Anzi (1989) A new algorithm to generate Arabic ... identification on a scale useful for IR remains problematic. Research on Arabic IR tends to treat automatic indexing and stemming separately. Al-Shalabi and Evans (1998) and El-Sadany and Hashish (1989) ... Adamson's algorithm on Arabic data to assess its ability to cluster words sharing a root. Each of the data sets was clustered manually to provide an ideal benchmark. This task was executed by a...
Ngày tải lên: 17/03/2014, 07:20
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... 56-kilodalton protease. Infect Immun 58, 1269–1272. 7 Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aerugi- nosa ... zinc- metalloproteinase from Serratia marcescens. Biochim Biophys Acta 955, 77–85. 6 Oda T, Kojima Y, Akaike T, Ijiri S, Molla A & Maeda H (1990) Inactivation of chemotactic activity of C 5a by the serratial ... proteases in the latter sub- family, beside the $ 56 kDa metallo-endoprotease of Serratia marcescens (serralysin), are the alkaline protei- nase of Pseudomonas aeruginosa, the ZapA metallo- protease...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: "Using Decision Trees to Construct a Practical Parser" pdf
Ngày tải lên: 23/03/2014, 19:20
Báo cáo khoa học: "A Context-sensitive, Multi-faceted model of Lexico-Conceptual Affect" pdf
Ngày tải lên: 30/03/2014, 17:20
Báo cáo toán học: " Pretargeted immuno-PET of CEA-expressing intraperitoneal human colonic tumour xenografts: a new sensitive detection method" doc
Ngày tải lên: 20/06/2014, 20:20
Báo cáo hóa học: "Fabrication of a Highly Sensitive Chemical Sensor Based on ZnO Nanorod Arrays" doc
Ngày tải lên: 22/06/2014, 00:20
Oxford Thesaurus - An A-Z Dictionary Of Synonyms
... thousands of feet. adaptable adj. flexible, pliable, pliant, compliant, accommodative, tractable, malleable, ductile, versatile; alterable, changeable: Men, in general, are not as adaptable as ... 1.9 alarm 1.10 amalgam 1.11 anachronism 1.12 apart 1.13 arbitrary 1.14 ashamed 1.15 atmosphere 1.16 audacious 1.17 available 1.18 awake 1.19 B 2.0 babble 2.1 beach 2.2 bias 2.3 blab ... abominable. aboriginal n. native, indigene, autochthon; Colloq Australian Abo, Offensive Australian aborigine , Slang Australian contemptuous boong: Many aboriginals are not assimilated to...
Ngày tải lên: 19/08/2013, 09:54
Bạn có muốn tìm thêm với từ khóa: