conservation minerals extraction and development toward a realistic partnership

Development of a realistic finite element model of human head and its applications to head injuries

Development of a realistic finite element model of human head and its applications to head injuries

... membranes they are dura ma s, e ater, a barachnoida space as well as the pia mater The dura mater al m arachnoidea mater, sub is a tough fibrous a h, and dense membrane, while the arachnoid mater ... enoid bones as well as paired pari s s ietal and tempor bones, w ral while the fa acial bones are made up of the u unpaired vo omer and mandi ible as well as paire lacrimal, nasal, pa ed alatine, ... facial bones and cranial bones as well as intracranial injuries are evaluated based on the tolerance limits of the biomechanical parameters General trend of maximum intracranial biomechanical parameters...

Ngày tải lên: 10/09/2015, 09:04

347 368 0
Workforce Planning and Development Processes - A Practical Guide ppt

Workforce Planning and Development Processes - A Practical Guide ppt

... the administrative assistance of Louis Ramirez xv Abbreviations AAC Air Armament Center AAC/CC Commander, Air Armament Center AF /A1 M Air Force Directorate of Manpower and Organization AFMC Air ... centers and laboratory directorates – builds and maintains database of job background requirements and makes the data accessible to centers and laboratory directorates • centers and laboratory ... individual, the AFSC, command level, organizational type and kind, unit, organizational structure name, location, and functional category Methods, Data, and Tools HQ AFMC already has access to military...

Ngày tải lên: 06/03/2014, 20:20

70 493 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) ... vector was obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) ... TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); for Ga15 (5¢-AT...

Ngày tải lên: 07/03/2014, 16:20

14 473 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

... Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aeruginosa elastase II Kinetic analysis and identification ... insulin chain A (B) Change over time in the chromatographic peak area of cleavage fragments Note that the amount of fragments A1 , A2 and A4 decreases on longer exposure to PrtA cleavage (For details ... kDa metallo-endoprotease of Serratia marcescens (serralysin), are the alkaline proteinase of Pseudomonas aeruginosa, the ZapA metalloprotease of Proteus mirabilis and proetases A, B, C, G and W...

Ngày tải lên: 23/03/2014, 09:20

11 425 0
temple univ pr food and evolution toward a theory of human food habits jan 1987

temple univ pr food and evolution toward a theory of human food habits jan 1987

... Bangladesh (Lindenbaum), Amazonia (Johnson and Baksh, Good, Ross), Paraguay (Hawkes), Canadian sub-arctic (Winterhalder), Southeast Asia and Africa (Franke), Mexico (Pelto), Costa Rica (Edelman), ... Scotland, from Wales and from Ireland, from Denmark and from Holland [There are also] bacon and salt meat from Ireland; hams from Yorkshire and Germany and Spain; game from all the sporting ... Wilbert has observed of the Warao of the Orinoco delta "that some of the nutritionally most valuable game animals, especially tapir, and here and there also deer and paca, are traditionally tabooed"...

Ngày tải lên: 11/06/2014, 16:29

645 298 0
Design and development of a medical parallel robotfor cardiopulmonary resuscitation

Design and development of a medical parallel robotfor cardiopulmonary resuscitation

... medical aspects, a 3-PUU translational parallel manipulator was chosen and designed to satisfy the specific requirement The kinematic analysis was performed and the manipulatorreachable workspace ... R Di Gregorio and V Parenti-Castelli, A translational 3-DOF parallel manipulator,” in Advances in Robot Kinematics: Analysis and Control, J Lenarcic and M L Husty, Eds Norwell, MA: Kluwer, 1998, ... parallel mechanisms containing the planar four-bar parallelogram,” Int J Robot Res., vol 22, no 9, pp 717– 732, 2003 M Carricato and V Parenti-Castelli, “Kinematics of a family of translational...

Ngày tải lên: 04/08/2014, 09:54

9 473 0
báo cáo khoa học: " Roadside sobriety tests and attitudes toward a regulated cannabis market" pdf

báo cáo khoa học: " Roadside sobriety tests and attitudes toward a regulated cannabis market" pdf

... 'oppose', or 'not sure' Data analyses Because published data on attitudes about a taxed and regulated cannabis market in America are extremely sparse, we began with simple bivariate analyses Our focus ... each question to predict whether a participant was likely to agree to a regulated cannabis market as a function of gender, age, education, Democratic party affiliation, and being Caucasian Although ... would alter their opinion regarding a regulated cannabis market after learning of a roadside impairment test Again, gender, age, education, Democratic-party affiliation, and being Caucasian were...

Ngày tải lên: 11/08/2014, 18:20

6 264 0
Lipid extraction and cholesterol quantification a simple protocol

Lipid extraction and cholesterol quantification a simple protocol

... In the Laboratory and (iii) the advantages and disadvantages of vegetable and animal food sources, considering cholesterol-related health problems This work can be expanded in further lab sessions: ... can be done in a quantitative way, using a spectrophotometer; students can design a cholesterol standard curve and measure the absorbance of the blue–green complex at 550 nm and (ii) lipids can ... leads to fruitful discussions on scientific and health issues 104 Journal of Chemical Education • W Supplemental Material Instructions for the students and notes for the instructor are available...

Ngày tải lên: 02/08/2015, 14:08

2 159 0
Hyperscsi  design and development of a new protocol for storage networking

Hyperscsi design and development of a new protocol for storage networking

... connection and data reliability mechanism A UDP datagram has a header and a payload The application data is carried as payload and the header carries the necessary information for protocol operation A ... parameter to determine the total data transfer rate and packet loss ratio RBUDP separates the signaling control and data communication channel to achieve higher data transfer rate The analytical ... distance network scenario There are also other similar candidates, such as FOBS [81] and Tsunami [82] These approaches all share the same properties, namely: Separate the data and control channel...

Ngày tải lên: 16/09/2015, 15:54

169 516 0
Design and development of a self balancing bicycle using control moment gyro

Design and development of a self balancing bicycle using control moment gyro

... (CMG) as an actuator The control moment gyro (CMG) is typically used in a spacecraft to orient the vessel [5] Appling a CMG as an actuator to balance a bicycle is a creative and novel approach; and ... expensive of all momentumexchange actuators Its advantages are low cost, simplicity, and the absence of ground reaction Its disadvantages are that it consumes more energy and cannot produce large amounts ... and it consist of a Freescale real-time processor, a Xilinx reconfigurable field-programmable gate array (FPGA), and 110 bidirectional digital 27 I/O lines along with RS232, Ethernet, and analogue...

Ngày tải lên: 02/10/2015, 17:14

59 1,3K 0
Design and development of a bench top electro adsorption chiller

Design and development of a bench top electro adsorption chiller

... of the commercially-available adsorbent-adsorbate pairs are silica gelwater, zeolite-water, activated carbon-methanol and silica gel- methanol Among these pairs, the silica gel-water [17, 18] ... of the same material [27] Metal foams that have a high surface area to volume ratio and high thermal conductivity are potentially excellent candidates for high heat dissipating applications [27-29] ... generate refrigerant flow far greater than the usual gravity effect As a result, the foam is able to draw the surrounding liquid and makes all foam surface areas wet Foam material, owing to its capillary...

Ngày tải lên: 04/10/2015, 10:25

78 383 0
Design and development of a bioreactor for ligament tissue engineering

Design and development of a bioreactor for ligament tissue engineering

... histological analysis of the samples Her experiences and dedication to work make my work easier and simpler and provided me with adequate background to analyse the data I thank the administrative staff, ... ligaments of the knee, one on either side (lateral collateral ligament and medial collateral ligament), and two interior ligaments (anterior cruciate ligament (ACL) and posterior cruciate ligament), ... structural and functional properties of the engineered tissues There are several uniaxial and equibiaxial cell stretchers available today in the literature and commercially The uniaxial stretchers allow...

Ngày tải lên: 04/10/2015, 10:25

141 240 0
Design and development of a CMOS power amplifier for digital applications

Design and development of a CMOS power amplifier for digital applications

... operating at Class A, second stage is operating at Class AB and third stage is operating at Class C Last but not least, the final stage is operating as Class D amplifier The final stage transistor ... inductance value with the smallest area The spiral inductor can be of rectangular shape, octagonal shape, circular or other shapes 2.3.2 Capacitor There are a few ways to realize a capacitor in a ... the parasitic capacitance can be lumped to the main capacitance Another alternative is to use a MOS capacitor, which is actually the gate capacitance of a MOS transistor As the gate length of...

Ngày tải lên: 04/10/2015, 10:25

103 420 0
Design and development of a social robotic head   dorothy

Design and development of a social robotic head dorothy

... eyebrows, arms, hands, legs Android exhibits appearance (and behavior) which is as close to a real human appearance as technically possible 15 Roomba AUR Mechanoid BotBrain Nexi Humanoid Saya Android ... This classification is based on the definition of mechanoid and humanoid adopted by Gong and Nass [10] and Android from Mac-Dorman and Ishiguro [11] Mechanoid is a robot that is relatively machine-like ... relatively machine-like in appearance and has no overtly human-like features Humanoid is not realistically human-like in appearance and readily perceived as a robot by human interactants However, it will...

Ngày tải lên: 04/10/2015, 10:26

99 347 0
Software Design and Development (A guide) is help you how to managed IT Project. Especially for Design and Develop software project.

Software Design and Development (A guide) is help you how to managed IT Project. Especially for Design and Develop software project.

... Initiation Phase Requirement Mission analysis stage Concept Dev Stage Development Phase System analysis stage System design stage Construct & acq stage User accept stage Operation and Maintenance ... create, lay out and describe, review, improve, and approve the design Day - Software Design Design includes an evaluation of the adequacy of the detailed technical requirements, an evaluation ... choices, and a verification that the design satisfies all requirements and design objectives Day - Software Design Software Design Inputs Software structure diagram & the requirements All associated...

Ngày tải lên: 15/10/2013, 23:13

88 649 0
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

... Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are the most important vectors  International shipping, aquaculture ... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... Framework  Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Management capabilities and approaches  APEC and the MRCWG have a...

Ngày tải lên: 28/10/2013, 11:15

10 584 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from ... of the mouse, and will accelerate the molecular and cellular analysis of ECs and their heterogeneity in various vascular beds 1994 Construction of the transgene Total RNA was extracted using TRIzol...

Ngày tải lên: 18/02/2014, 17:20

11 874 0
Tài liệu Báo cáo khoa học: "A Mobile Touchable Application for Online Topic Graph Extraction and Exploration of Web Content" ppt

Tài liệu Báo cáo khoa học: "A Mobile Touchable Application for Online Topic Graph Extraction and Exploration of Web Content" ppt

... explicit relationships that are generated from an online Encyclopedia (in our case Wikipedia) The relevant background relation graph is also represented as a touchable graph in the same way as a topic ... like EEUU and NLF, questions about persons like Justin Bieber, David Beckham, Pete Best, Clark Kent, and Wendy Carlos , and general themes like Brisbane, Balancity, and Adidas The task was not only ... the search results After each task, both testers had to rate several statements on a Likert scale and a general questionnaire had to be filled out after completing the entire test Table and show...

Ngày tải lên: 20/02/2014, 05:20

6 458 0
Tài liệu Báo cáo khoa học: "A HARDWARE ALGORITHM FOR HIGH SPEED MORPHEME EXTRACTION AND ITS IMPLEMENTATION" pptx

Tài liệu Báo cáo khoa học: "A HARDWARE ALGORITHM FOR HIGH SPEED MORPHEME EXTRACTION AND ITS IMPLEMENTATION" pptx

... the parsing However, it is more laborious for Japanese and several other languages, which have no explicit word boundaries, than for Engllsh and many European languages (Miyazald, 1983) (Ohyama, ... ~Igorithm is very suitable for text with a large character set, such as Japanese (more than 5,000 different chaxacters are computer re~able in Japanese) This algorithm ~Iso has the advantage of high speed ... amount of ambignJty, in that a character or a syllable has multiple candidates Such multiple candidates form the multiple text streams Figure 6 (a) shows an example of multiple text streams, expressed...

Ngày tải lên: 21/02/2014, 20:20

8 504 0
A Practical Approach to Water Conservation for Commercial and Industrial Facilities pot

A Practical Approach to Water Conservation for Commercial and Industrial Facilities pot

... Shanghai Dhaka Delhi Buenos Aires Jakarta Osaka Rio de Janeiro Karachi Japan Mexico Brazil USA India USA India China Bangladesh India Argentina Indonesia Japan Brazil Pakistan Source: UN Habitat: ... Europe North America Central America North Africa Central and South Asia Middle East Southeast Asia Central Africa South America Southern Africa Oceanania Virtual water trade balances of thirteen ... A Practical Approach to Water Conservation for Commercial and Industrial Facilities A Practical Approach to Water Conservation for Commercial and Industrial Facilities Mohan Seneviratne...

Ngày tải lên: 06/03/2014, 17:20

395 453 0
w