connecting to an oracle database in c

... OracleConnection conn = new OracleConnection( ConfigurationSettings.AppSettings[ "Oracle_ Scott_ConnectString"]); resultTextBox.Text = "Connection with ORACLE Provider" + Environment.NewLine; ... Oracle, OLE DB, and ODBC These alternatives are discussed in the following subsections Native Oracle The Microsoft Oracle NET data provider accesses an Oracle database using the Oracle Call Interface ... native Oracle NET data provider where practical ODBC Finally, the ODBC NET data provider can connect to an Oracle database An example of the connection string is shown here: Driver={Microsoft ODBC...

Ngày tải lên: 24/12/2013, 05:15

Ngày tải lên: 29/03/2014, 16:20

... folder containing the database files The user account requires permissions to access the share that contains the database file and folders The user account must be recognized by the Access computer ... a domain user account, add it to the permissions list on both computers For a user account local to the IIS computer, create a duplicate account on the Access computer with the same name and password ... password Grant the user account Log on Locally and Access this Computer from the Network permission to access the computer in the local security policy These permissions are assigned within the Security...

Ngày tải lên: 07/11/2013, 13:15

... for ODBC connects to ODBC data sources through the OdbcConnection object The ODBC driver connection string is specified using the ConnectionString property It includes settings needed to establish ... the connection to the data source The connection string format closely matches the ODBC connection string format Additionally, you can specify an ODBC data source name (DSN) or file DSN by setting ... the OdbcConnection object that appears in the component tray Drag an OdbcConnection from the Data tab of the Toolbox onto a form or design surface Configure the ConnectionString property in the...

Ngày tải lên: 24/12/2013, 05:15

... GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC CGGCGCCAGTAGCCGACGAAG CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG GGAATTCCGCGCGCGGGTCTGGCTTCA ... GGAATTCCGCGCGCGGGTCTGGCTTCA RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR PCR cloning of the desA promoter Pr O6 hrdB-5 hrdB-3 CGGGATCCCGGTACTGCTCCGCGGTGGTGTCGTT GCGATCGCTGCCACTGC GCCGCCGCGCCAAGAACCA ... containing the apramycin resistance gene [aac(3)IV] and oriT was used as template The mutant was constructed using the oligonucleotides 5¢-acccc tctcggaccgtccccaccggaggacccccccatgATTCCGGGGATC 1118 This...

Ngày tải lên: 16/03/2014, 11:20

... database creation scripts 3-16 Copyright © 2005, Oracle All rights reserved Practice Overview: Using the DBCA This practice covers the following topics: • Creating the ORCL database by using the DBCA ... the DBCA • Unlocking the HR schema Note: Completing the database creation and unlocking the HR schema is critical for all following practice sessions Optionally: • Creating the ORCL database design ... Research and marketing data – State or federal tax payments – Professional licensing (doctors, nurses, and so on) • Transaction Processing: – Store checkout register system – Automatic teller machine...

Ngày tải lên: 01/07/2014, 08:39

... Match packets with CS3(precedence 3) dscp cs4 Match packets with CS4(precedence 4) dscp cs5 Match packets with CS5(precedence 5) dscp cs6 Match packets with CS6(precedence 6) dscp cs7 Match packets ... VGateway(config-pmap -c) #set dscp ! VGateway#show policy-map 228 Chapter 8: Connecting to an IP WAN Example 8-7 Marking Traf c Using a Policy Map (Continued) Policy Map COS -TO- DSCP Class COS-Voice set dscp ef Class class-default ... current recommendation is to set it to Class Selector (CS)3 You can use an access list to identify traf c with a certain DSCP value, or match against it in a class map Example 8-4 shows an access...

Ngày tải lên: 16/11/2014, 20:15

... resource can be mined The SolRgene database can be searched using each entity as a starting point, and the resource can be mined consecutively in an iterative manner resistance to P infestans isolates ... effector genomics is Page of emerging as an efficient tool to accelerate R gene cloning, often in combination with small-scale genetic mapping and allele-mining [14] Genetic studies are facilitated ... well-characterized P infestans strains Indeed we found that in many cases variation of resistance occurs within accessions, and that resistant as well as susceptible genotypes occur, e.g in S acaule accession...

Ngày tải lên: 11/08/2014, 11:21

... defining public concern, determining multiple issues, defining measurable indicators, and interpreting information on measured indicators to derive conclusions In view of the purpose of the elicitation ... scientific disciplines, tools, interests and other aspects in a systemic way in order to increases the efficiency of our actions 1.2.3 Integrated management and policy analysis Integrated management ... to change in social systems, and complexity System analysis is concerned with theorizing, choosing and acting Hence, its character is threefold: descriptive (science), prescriptive (advisory) and...

Ngày tải lên: 06/11/2012, 10:35

... e) { // Create the command to retrieve employee image specified SqlConnection conn = new SqlConnection( ConfigurationSettings.AppSettings["DataConnectString"]); String sqlText = "SELECT * FROM ... Request["EmployeeId"].ToString( ); SqlCommand cmd = new SqlCommand(sqlText, conn); // Create a DataReader containing the record for the employee conn.Open( ); SqlDataReader dr = cmd.ExecuteReader( ); ... by setting the HTTP MIME type of the output stream to image/bmp and writing the image to the stream The C# code for the code-behind is shown in Example 7-15 Example 7-15 File: ADOCookbookCS0707b.aspx.cs...

Ngày tải lên: 28/10/2013, 18:15

... Create a connection SqlConnection conn = new SqlConnection( ConfigurationSettings.AppSettings["Sql_ConnectString"]); // Create a command to retrieve the employee photo String sqlText = "SELECT ... BindingManagerBase object by Move Last Button.Click Sets the current record of the bound controls to the last record by setting the Position property of the BindingManagerBase object to the total ... used to instantiate a BindingManagerBase object and either a CurrencyManager or PropertyManager object is returned depending on the type of data source: • • The CurrencyManager class inherits...

Ngày tải lên: 28/10/2013, 18:15

... in making an utterance is that part of the total act which causes such effects 2.3 Direct, indirect and nonliteral speech acts Speech acts are also classified as direct and indirect speech acts ... admitting, apologizing, challenging, complaining, condoling, congratulating, declining, giving permission, giving way, greeting, leave-taking, mocking, naming, offering, praising, promising, proposing ... auditory means, such as speaking, singing and sometimes tone of voice, and nonverbal, physical means, such as body language, sign language, paralanguage, touch, eye contact, by using writing Communication...

Ngày tải lên: 11/12/2013, 23:51

... object to connect to the // database, passing the connection string to the constructor OleDbConnection myOleDbConnection = new OleDbConnection(connectionString); // create an OleDbCommand object ... connect to the // database, passing the connection string to the constructor OleDbConnection myOleDbConnection = new OleDbConnection(connectionString); // create an OleDbCommand object OleDbCommand ... object to connect to an Access database */ using System; using System.Data; using System.Data.OleDb; class OleDbConnectionAccess { public static void Main() { // formulate a string containing...

Ngày tải lên: 24/12/2013, 01:17

... result.Append("ConnectionString: " + Environment.NewLine + connectionString + Environment.NewLine + Environment.NewLine); OleDbConnection conn = new OleDbConnection(connectionString); try { conn.Open( ... result.ToString( ); } Discussion A Microsoft Access database password requires that users enter a password to obtain access to the database and database objects This is also known as share-level security ... or users to have distinct levels of access or permissions Anyone with the password has unrestricted access to the database The Set Database command from the Tools database password Security menu...

Ngày tải lên: 24/12/2013, 05:15

... Environment.NewLine; result.Append(connectionString); // Create the connection OleDbConnection conn = new OleDbConnection(connectionString); try { // Attempt to open the connection conn.Open( ); ... provider-specific connection string attributes in addition to those defined by ADO.NET To open a database secured by Microsoft Access user-level security, use the Jet OLEDB:System Database attribute in ... Discussion Microsoft Access user-level security requires an additional file—the workgroup information or MDW file in addition to the database or MDB file This file contains the user and group information...

Ngày tải lên: 24/12/2013, 05:15

... Production on Mon Dec 21:22:02 2004 Copyright (c) 1982, 2002, Oracle Corporation All rights reserved Connected to an idle instance SQL> startup pfile=d:\db18\initdb18.ora ORACLE instance started Total ... PC 13 Connect again as sysdba to default database sqlplus/nolog, SQL>conn sys /oracle as sysdba check which database you are in 14 If it is not db18 set oracle sid as we did before in another command ... prompt sqlplus/nolog and in sql prompt type conn sys/ceylonlinux_suranga as sysdba then you should see that you are connected to an idle instance Now start the instance in nomount mode as, startup...

Ngày tải lên: 25/01/2014, 05:20

... the connection ADODB.Connection conn = new ADODB.ConnectionClass( ); conn.Open(ConfigurationSettings.AppSettings["MsAccess_ConnectString"], "", "", 0); // Create an ADOX catalog object for the connecton ... OleDbConnection conn = new OleDbConnection( ConfigurationSettings.AppSettings["MsAccess_ConnectString"]); conn.Open( ); // Retrieve schema information for all tables DataTable schemaTable = conn.GetOleDbSchemaTable(OleDbSchemaGuid.Tables, ... result.Append(Environment.NewLine); } } cat = null; conn.Close( ); resultTextBox.Text = result.ToString( ); Discussion The solution shows two techniques that you can use to get a list of tables in an Access database...

Ngày tải lên: 26/01/2014, 10:20

... (lines 1–3) and 50 lgÆmL)1 (lines 4–6) (C) Increased binding of pH bufferexposed IVIg to recombinant human IFN -c (D) Increased binding of low-pH buffer-exposed IVIg to human factor H In both panels, ... significantly change the reactivity to Bacillus anthracis antigens In contrast, the transient exposure of IVIg to pH 2.8 buffer resulted in a significant (P < 0.05) enhancement of immunoreactivity, and ... enhanced binding to bacterial antigens as well as to self-antigens, owing to structural changes in the immunoglobulin molecules The modified preparation is shown to have a protective effect in...

Ngày tải lên: 16/02/2014, 15:20

... = cc.owner AND c. owner = UPPER('&&schema') AND c. constraint_name = cc.constraint_name AND c. constraint_type = 'R' GROUP BY c. owner, c. table_name, c. constraint_name) cons LEFT OUTER JOIN (SELECT ... available, and strategies for choosing which table and column combinations to index A correct indexing methodology is central to achieving maximum performance for your database This chapter introduces ... cons.cols FROM (SELECT c. owner, c. table_name, c. constraint_name ,LISTAGG(cc.column_name, ',' ) WITHIN GROUP (ORDER BY cc.column_name) cols FROM dba_constraints c ,dba_cons_columns cc WHERE c. owner...

Ngày tải lên: 17/02/2014, 11:20

... statistics, speak to your finance director or planning team An Insider’s Guide to Finance and Accounting in Higher Education Costing and pricing Without going into too much technical detail, it’s ... and indirectly-incurred costs (eg space occupied) Further additions may be necessary to reflect financing and infrastructure costs An Insider’s Guide to Finance and Accounting in Higher Education ... How budgeting works in practice Other inputs to financial planning The importance of operating strategically Balancing today against tomorrow Bean-counting Financial security Comparative analysis...

Ngày tải lên: 18/02/2014, 01:20