... engaged in medical research and clinical practice A physician’s personal experiences and moral ideas about science, tradition, and religion shaped their methodology and practical concerns Between ... American Medical Association in 1876, president of the International Medical Congress in 1877, and president of the American Gynecological Society in 1880 When he died in 1883 the medical society ... his cultural ties to the American South as the context of his early gynecological experiments and subsequently successful medical career Born in 1813, he grew up in the rural backcountry context...
Ngày tải lên: 05/03/2014, 15:20
... this process so difficult to achieve? How can we succeed in lighting the sugar cube with the burning match? 19 Water Boiling Decaffeinated coffee still contains caffeine! A regular cup of coffee ... 100? 24 Electric Pickle Some specialty and novelty stores sell an electrical “appliance” that cooks hot dogs between two metal electrodes A protective cover with a safety interlock Night cooling ... the clock continue to keep accurate time? 43 Time Reversal Frame 16 Mad about Modern Physics Frame A movie is made showing successive frames for an object accelerating downward If the sequence...
Ngày tải lên: 17/03/2014, 14:02
Modern differential geometry for physicists 2nd ed , c isham
... Scientific Lecture Notes in Physics - Vol 61 Modern Differential Geometry for Physicists Second Edition Chris J lsham Theoretical Phvsics G r o w Imperial College of Science, fechnology and Medicine ... idea of a metric space The concept of a distance function can be generalised t o an arbitrary set X by extracting the crucial properties vis-a-vis convergence of the Euclidean distance d(Z,y3 defined ... key concepts are developed in a way that is manifestly independent of any specific reference to coordinates Concomitantly, the fact that a manifold is actually a special type of topological space...
Ngày tải lên: 17/03/2014, 14:31
the cambridge companion to modern latin american culture
... Anglican Church competed with many other Protestant churches, the Iberian colonies were 17 18 Companion to Modern Latin American Culture dominated by a single, established Catholic Church which ... which they could exercise political influence commensurate with their economic and social standing Matching this political advance was a growing cultural selfconfidence This was particularly conspicuous ... Montreal Her research focuses on contemporary Caribbean culture, especially the Hispanic Caribbean Her current project explores how Caribbean culture and Caribbean culture critics have responded...
Ngày tải lên: 04/05/2014, 13:04
the scientific american book of projects for the amateur scientist - c stong (simon and schuster, 1960)
... experiment with the optical effect that imparts color to soap bubbles and blueness to the bluebird A PIEZOELECTRIC CLOCK 532 The accuracy of electric clocks depends on the care with which the operator ... by means of electrostatic attraction — and you can accurately measure the charge on a single electron VII MATHEMATICAL A PUZZLE-SOLVING MACHINES MACHINE 377 It attacks the classic problem of the ... excursions across the boundaries of many scientific disciplines including optics, mechanics, electronics, chemistry and solid-state physics The concluding discussions take up instruments demonstrating...
Ngày tải lên: 12/05/2014, 16:40
chambers c hollyday a k modern inorganic chemistry (1975)
... ions concerned and is not dictated by directed forces of attraction* We can correctly assume the non-directional forces of attraction holding the ions together to be electrostatic in nature MOLECULAR ... to act as a lone pair acceptor is not confined to Group III, and can occur wherever a quantum level is incomplete This ability to accept electrons explains why covalent chlorides, with the exception ... physico-chemical property ionisation energy and those chemical properties which depend on the degree of metallic (electropositive) character of the elements in the group If we consider the successive...
Ngày tải lên: 04/06/2014, 13:18
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... II 100 150 cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain II a g u u c 200 gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT 283 B Background1 Background2 Background3...
Ngày tải lên: 18/06/2014, 18:20
Project Gutenberg''''s Darwin and Modern Science, by A.C. Seward and Others pot
... THIS PROJECT GUTENBERG EBOOK DARWIN AND MODERN SCIENCE *** Produced by Sue Asscher, and David Widger DARWIN AND MODERN SCIENCE ESSAYS IN COMMEMORATION OF THE CENTENARY OF THE BIRTH OF CHARLES DARWIN ... intellect of Darwin, his character, as Huxley wrote, was even nobler than his intellect A .C SEWARD Botany School, Cambridge, March 20, 1909 CONTENTS PREFACE DATES OF THE PUBLICATION Of CHARLES ... reflected, and never ceased working for the next twenty years Had been greatly struck from about the month of previous March on character of South American fossils, and species on Galapagos Archipelago...
Ngày tải lên: 28/06/2014, 19:20
Báo cáo lâm nghiệp: "Results of Czech-American cooperation in interspecific fir hybridization in 2008 and 2009" pot
... polymix of these clones collected in 2006 In Czech seed orchards the pollen of Abies cilicica × Abies cephalonica hybrid (clones CZ1 and CZ2) was collected This pollen from seed orchard No has been ... 2009 91 CZ1 × NC52 11 – – – CZ1 × NC73 – 11 – – – CZ1 × NC136 – – – – CZ2 × NC136 – – – – – CZ1 × NC84 – – – – CZ1 × PC – – – – CZ2 × PC – – – – CZ1 × A bal – – – – – CZ1 × A fras – – – – – CZ2 × ... to trace any trend in performance of any hybrid combination The most successful hybrid combination CZ1 × NC73 brought 16% of viable seeds CZ1 × PC (10%), CZ1 × NC136 (7%) and CZ2 × PC (4%) can...
Ngày tải lên: 07/08/2014, 10:21
CÔNG LAO CỦA NGUYỄN ái QUỐC đối với CÁCH MẠNG VIỆT MAM từ 1911 – 1920
... một Đảng tiến bộ, chủ trương chông lại ca c chính sách áp bư c, bo c lột của thư c dân Pháp ở thuô c địa Ngày 18-6-1919, nhân dịp ca c nươ c thắng trận chiến tranh thế gới ... A-Mu c tiêu của chuyên đề: 1-Kiến thư c: - Trên sở kiến thư c HS đã ho c chương trình SGK Lịch sử lớp 11,12 Chuyên đề nhằm giúp HS củng c kiến thư c, nắm vững kiến thư c một cách ... qua ca c m c thời gian Chỉ c ̀n khoảng 10 m c thời gian là HS có thể hình dung đươ c mạch và nắm đươ c nội dung bản của chuyên đề về thời ky hoạt động của Nguyễn Ái Qu c kéo...
Ngày tải lên: 23/10/2015, 15:22
Modern c++ design generic programming and design patterns applied
... container classes Policy-based classes support flexibility when it comes to conversions If you use policy-by-policy copying, each policy can control which other policies it accepts, or converts to, by ... interface pertaining to a specific issue You can implement policies in various ways as long as you respect the policy interface Because you can mix and match policies, you can achieve a combinatorial ... The two policies can be defined as follows: Checking: The CheckingPolicy class template must expose a Check member function, callable with an lvalue of type T* SmartPtr calls Check, passing...
Ngày tải lên: 04/02/2016, 11:13
The routledge dictionary of modern american slang and unconventional english
Ngày tải lên: 05/04/2016, 18:56
Effective Modern C++
... Mean C+ + All C+ +98 C+ +98 and C+ +03 C+ +11 C+ +11 and C+ +14 C+ +14 C+ +14 As a result, I might say that C+ + places a premium on efficiency (true for all ver‐ sions), that C+ +98 lacks support for concurrency ... Effective Modern C+ + is a towering achievement from a consummate technical writer It layers lucid, meaningful, and well-sequenced clarifications on top of complex and interconnected topics, all ... param); // conceptual template for // deducing cx's type func_for_cx(x); // conceptual call: param's // deduced type is cx's type template void func_for_rx(const T& param); // conceptual...
Ngày tải lên: 22/04/2016, 13:52
Modern C Ngôn ngữ lập trình C
... which numerical constants, so-called literalsC can be specified: 123 decimal integer constantC The most natural choice for most of us 077 octal integer constantC This is specified by a sequence ... How a concrete executable achieves this goal is left to the discretion of the compiler creators Most modern C compilers produce code that doesn’t follow the exact code prescription, they cheat ... constants generally lead to different values for the same literal A typical example: literal value float 0.2F 0x1.99999AP-3F double 0.2 0x1.999999999999AP-3 long double 0.2L 0xC.CCCCCCCCCCCCCCDP-6L...
Ngày tải lên: 06/08/2016, 14:45
1500 Test C.pdf
... rate c a chair c a look c b picture c lecture d furniture b how c cow d row b cough c although d rough b only c lone d bone b late c private d date b cheap c chemist d child b book c soon ... Reagan > c 44 We can't reduce the number of nurses a cut back on b cut off on c cut out on d cut out a 45 Put on your coat just ………… it becomes cold a in fact b in time c in order d in case > ... had been coming c has come d has been coming a 29 I tried the bus, but I missed it a catching b to catch c catch d catch up >b 30 Women only began to gain with men in the 20th century a...
Ngày tải lên: 05/08/2012, 12:27
History Of Modern Biotechnology II
... at the concentration gradients of vesicles, as observed by Collinge and Trinci [70], then the picture changes completely In fact, the values of C (x) calculated Fig Concentration of vesicles (number/mm ... Penicillium chrysogenum Candida utilis Escherichia coli Rhodopseudomonas sphaeroides Tetracycline by Streptomyces aureofaciens Gluconic acid by Aspergillus niger Poly-b-hydroxy-butyric acid by ... streptomycin processes By a specific change in down-stream processing, a proteolytic enzyme complex could be obtained in addition to the main product, streptomycin This by-product, after concentrating...
Ngày tải lên: 08/08/2012, 09:49
History of Modern Biotechnology I - Springer
... metabolites such as glutamic acid and citric acid accumulate after growth in very large amounts Cultural conditions are often critical for their accumulation and in this sense, their accumulation ... important in colonization of the human intestinal tract by Escherichia coli early in life Cyanobacteria cause human and animal disease by producing cyclic heptapeptides (microcystins by Microcystis) ... sclerotia which act against the corn earworm insect, Helicoverpazea Similarly, sclerotia of Claviceps spp contain ergot alkaloids in high concentration which are considered to protect the sclerotia...
Ngày tải lên: 08/08/2012, 09:52
Bảo quản thực phẩm
... phitin, têch ly c c axit hỉỵu c tỉì c c cacbuahydro dỉåïi t c dủng ca VSV, têch ly c c axit bẹo tỉû tỉì c c cháút bẹo dỉåïi t c dủng ca enzim phitaza C åìng âäü ca c c quạ trçnh ny tàng cng våïi ... th c â åí nhiãût âäü 40 0C v âäü áøm ca khäng khê l 80% Âäúi våïi cháút ca c c tia sạng, våïi c c tia sạng nhçn tháúy thç c c tia c bỉå c sọng ngàõn c t c dủng kêch thêch sáu hải mảnh hån c c ... quanh chäù c ạnh sạng Låi dủng âà c ny ta c thãø tiãu diãût âỉå c sáu hải kho 5/ T c dủng c hc : Sáu mt l nhỉỵng sinh váût c kêch thỉå c âạng kãø nãn chụng dãù bë chãút c c va chảm c hc lục...
Ngày tải lên: 11/08/2012, 12:43