comparison of means of two samples the t test

Báo cáo lâm nghiệp: "Variation in the composition and content of ellagitannins in the heartwood of European oaks (Quercus robur and Q petraea). A comparison of two French forests and variation with heartwood age" ppt

Báo cáo lâm nghiệp: "Variation in the composition and content of ellagitannins in the heartwood of European oaks (Quercus robur and Q petraea). A comparison of two French forests and variation with heartwood age" ppt

... the concentration of ellagitannins in north -and south-facing staves of each tree plotted on opposing axes As well as illustrating the difference between the two forests, the fact that most of ... years The difference in total ellagitannins between the two samples is greater than that indicated from the earlier calculations, suggesting that the earlier assumptions over-rather than underestimated ... Wilcoxon two- sample test of rank sums (SAS Institute Inc, 1985; Neave and Worthington, 1988) Both the parametric and nonparametric tests found significant differences between the two sites for most of...

Ngày tải lên: 08/08/2014, 18:21

14 384 0
Báo cáo khoa học: " Comparison of two sap flow methods for the estimation of tree transpiration" ppt

Báo cáo khoa học: " Comparison of two sap flow methods for the estimation of tree transpiration" ppt

... stemcores [5] The precision in the estimation of the transpiration depends on the accuracy of the differential temperature measurement The thermocouples must be protected against direct radiation ... disadvantages (table I), it is interesting to use the two methods in a complementary way and also to compare the results from the same stem In this note, a methods on the of the two trunk has been comparison ... In the case of our installation with homemade Graniers probe close to the soil surface, it is important to take into account the natural temperature gradient between the two probes without any...

Ngày tải lên: 08/08/2014, 23:22

7 326 0
Báo cáo y học: "Acute pressure overload of the right ventricle. Comparison of two models of right-left shunt. Pulmonary artery to left atrium and right atrium to left atrium: experimental study" doc

Báo cáo y học: "Acute pressure overload of the right ventricle. Comparison of two models of right-left shunt. Pulmonary artery to left atrium and right atrium to left atrium: experimental study" doc

... data are available regarding the effects of a shunt not at the atrial level but from the pulmonary artery to the left atrium The purpose of this study was to examine the effects of right ventricle ... evaluation of the overall picture The use of other acute RVF models and the determination of long term results are a matter of further investigations Abbreviations RV: Right Ventricle; RA: Right Atrium; ... direction (meters), R: is the radius Because of the anatomical contiguity between pulmonary artery and left atrium, the length of the PA-LA graft is always shorter than the RA-LA graft The pressure...

Ngày tải lên: 10/08/2014, 09:22

10 337 0
Comparison of Methods for the Extraction of Bioflocculants from Activated Sludge

Comparison of Methods for the Extraction of Bioflocculants from Activated Sludge

... NaOH-extracted polymer exhibited the greatest activity, and the washing-extracted polymer possessed the lowest Among the cations tested, calcium and magnesium ions showed the greatest benefit on activity ... estimate polymer concentration, the polymer concentration in a test tube was increased from 2.5 to 20 ppm Effect of cations on flocculating activity To estimate the effect of cations on flocculating ... calculated every minute using the following formula: The relative A660 = A660 of flocculating test A660 of control test For the control, the polymer solution was replaced by distilled water To estimate...

Ngày tải lên: 05/09/2013, 09:08

11 695 1
Application and Comparison of Two Biotic Ligand Models Predicting Copper Toxicity and Accumulation in Heavy Metal Tolerant Moss

Application and Comparison of Two Biotic Ligand Models Predicting Copper Toxicity and Accumulation in Heavy Metal Tolerant Moss

... indicating that the fraction of the BL bound by copper represent the bioavailability much better than the total metal concentration Table shows the stability constants for the toxicity model and the ... difference in the stability constant of proton for the toxicity model and for the accumulation model The BLM in the present state does not consider these differences between the toxicity model and the ... hygrometrica was extremely lower than that of D magna It is indicated that tolerance to copper should affect the stability constant On the other hand, every stability constant of the accumulation model...

Ngày tải lên: 05/09/2013, 10:15

7 432 0
Comparison of Two Synthesis Routes to Obtain Gold Nanoparticlesin Polyimide

Comparison of Two Synthesis Routes to Obtain Gold Nanoparticlesin Polyimide

... the photothermal effect of the GNPs However, this difference in temperature is not reflected in the filtration data It should be kept in mind that the heating experiments were carried out in a static ... substructure toward the bottom of the photo For both methods, the mean particle size is around 3À5 nm, depending on the gold content of the membrane There is one clear difference between the IRS ... loss of intensity in the laser pathway The laser was set at an intensity of 0.2 W/cm2 Permeances were calculated as the amount of solvent (V) that passed through the membrane per unit of time (t) ,...

Ngày tải lên: 18/09/2013, 21:27

11 451 0
Báo cáo khoa học: Structure and positioning comparison of two variants of penetratin in two different membrane mimicking systems by NMR pdf

Báo cáo khoa học: Structure and positioning comparison of two variants of penetratin in two different membrane mimicking systems by NMR pdf

... in Fig together with the results obtained for penetratin, and it can be seen that the trends in the results are similar Notably, there is a significant effect of the Mn2+ ions on the C-terminal ... peptide–lipid NOEs, together with the fact that Mn2+ ions seem to affect the head-group region of the lipids suggest that the peptide resides within the phospholipid head-group layer, at the interface ... Therefore it is safe to assume that penetratin most likely interacts with the charged surface of the negatively charged bicelles while it does not interact with the DHPC rim There is a slight...

Ngày tải lên: 23/03/2014, 18:20

9 373 0
Báo cáo sinh học: " Genome comparison of two Coccolithoviruses" doc

Báo cáo sinh học: " Genome comparison of two Coccolithoviruses" doc

... function in these strains suggests their importance to these viruses, adding further credence to the hypothesis that the Coccolithovirus genus has lifestyle distinct from other members of the ... predicted start of translation methionine codon (ATG to ATA) and a bp deletion that would otherwise cause a frameshift It therefore appears likely that, in EhV-163 at least, the start of translation ... occurs from the ATG that is present 36 bp downstream of current predicted ATG start codon of ehv381 in EhV-86 There appears to be a high degree of variation in ehv142 between the two strains The CDS...

Ngày tải lên: 19/06/2014, 08:20

6 276 0
báo cáo hóa học: " Work and diet-related risk factors of cardiovascular diseases: comparison of two occupational groups" doc

báo cáo hóa học: " Work and diet-related risk factors of cardiovascular diseases: comparison of two occupational groups" doc

... by the results from the stress self-assessment test The stress suffered by the chefs was more frequently job-related rather than resulting from other causes They apparently responded to this stress-related ... selectively removed back to the intestine [17] Both oxidative stress and the concentrations of antioxidants provide additional information concerning the risk of CD Oxidative stress contributes to ... 25th or the 75th percentile (P25-P75), respectively The comparison of the professional groups was analysed using Mann-Whitney-U test Pearson’s c2 test was used to estimate the frequency of distribution...

Ngày tải lên: 20/06/2014, 00:20

8 449 0
Báo cáo hóa học: " Comparison of p53 and the PDZ domain containing protein MAGI-3 regulation by the E6 protein from high-risk human papillomaviruses" pdf

Báo cáo hóa học: " Comparison of p53 and the PDZ domain containing protein MAGI-3 regulation by the E6 protein from high-risk human papillomaviruses" pdf

... molecular weight degradation products were detected on this Western blot with the anti-GFP antibodies, this suggests that the E6-GFP fusion proteins remained intact in the transfected cells In the presence ... to T A to C A to C A to T C to T C to T A to V L to R K to N P to T F to F (none) I to L V to L N to H K to N R to R (none) A to V S to S (none) Codon positions of polymorphisms pertaining to the ... EcoRI (3') restriction sites The upstream primer sequence was 5'CAGATCTCATGTTTCAAGACACTGAGGAAAAACCAC while the downstream primer sequence was 5'CAGAATTCGTCACAGTGCAGTTTCT-CTACGTCGG The amplified...

Ngày tải lên: 20/06/2014, 01:20

9 383 0
báo cáo hóa học:"Genome comparison of two Coccolithoviruses" doc

báo cáo hóa học:"Genome comparison of two Coccolithoviruses" doc

... function in these strains suggests their importance to these viruses, adding further credence to the hypothesis that the Coccolithovirus genus has lifestyle distinct from other members of the ... predicted start of translation methionine codon (ATG to ATA) and a bp deletion that would otherwise cause a frameshift It therefore appears likely that, in EhV-163 at least, the start of translation ... occurs from the ATG that is present 36 bp downstream of current predicted ATG start codon of ehv381 in EhV-86 There appears to be a high degree of variation in ehv142 between the two strains The CDS...

Ngày tải lên: 20/06/2014, 04:20

6 435 0
báo cáo hóa học:" A comparison of two headless compression screws for operative treatment of scaphoid fractures" doc

báo cáo hóa học:" A comparison of two headless compression screws for operative treatment of scaphoid fractures" doc

... then made prior to osteotomy to ensure post-osteotomy rotational alignment The required screw length was measured, with the width of the load cell taken into account The scaphoid was then Scaphoid ... microsagittal saw was used to create an osteotomy perpendicular to the long axis of the scaphoid simulating a transverse waist fracture The fracture was reduced with the load cell interposed between the ... Acutrak Synthes Figure The mean compression (±1 standard deviation) of the Acutrak and Synthes screws as measured from insertion to 180s after steady state failure with the first insertion of...

Ngày tải lên: 20/06/2014, 04:20

6 550 0
báo cáo hóa học:" A comparison of two headless compression screws for operative treatment of scaphoid fractures" pdf

báo cáo hóa học:" A comparison of two headless compression screws for operative treatment of scaphoid fractures" pdf

... then made prior to osteotomy to ensure post-osteotomy rotational alignment The required screw length was measured, with the width of the load cell taken into account The scaphoid was then Scaphoid ... microsagittal saw was used to create an osteotomy perpendicular to the long axis of the scaphoid simulating a transverse waist fracture The fracture was reduced with the load cell interposed between the ... Acutrak Synthes Figure The mean compression (±1 standard deviation) of the Acutrak and Synthes screws as measured from insertion to 180s after steady state failure with the first insertion of...

Ngày tải lên: 20/06/2014, 07:20

6 404 1
báo cáo hóa học:" Proximal screws placement in intertrochanteric fractures treated with external fixation: comparison of two different techniques" pdf

báo cáo hóa học:" Proximal screws placement in intertrochanteric fractures treated with external fixation: comparison of two different techniques" pdf

... possible to the medial cortex and at the center of the femoral neck in the lateral view The appropriate position of the K-wire was confirmed by fluoroscopy at this point Attention was paid to Fifty-three ... to the medial cortex and at the center of the femoral neck by rotating the screw guide around the K-wire axis The second screw was inserted parallel to the first one, following the screw seat of ... in multiple injured patients with complex fractures of the subtrochanteric region [19,20] The authors had the experience with the application of pertrochanteric external fixator This study was...

Ngày tải lên: 20/06/2014, 07:20

7 234 0
Báo cáo lâm nghiệp: "Comparison of two types of ECOLURE lure on Ips typographus (L.) (Coleoptera: Scolytidae)" doc

Báo cáo lâm nghiệp: "Comparison of two types of ECOLURE lure on Ips typographus (L.) (Coleoptera: Scolytidae)" doc

... t- test (dependent samples) in the case of normal data distribution and by Wilcoxon matched pairs test in the case of other data distribution Differences in ten-day checkings and also in the total ... special transparent plastic tube with free filling in the case of ECOLURE TUBUS Spatial experiment design The study was conducted near the town of Písek (south Bohemia) in the Záhoří managementplan ... number of trapped beetles were tested Relative efficiency was calculated for single checking as the ratio of the number of trapped beetles by ECOLURE CLASSIC to the number of beetles trapped...

Ngày tải lên: 07/08/2014, 10:22

5 339 0
Báo cáo lâm nghiệp: "A comparison of two modelling studies of environmental effects on forest carbon stocks across Europe" ppsx

Báo cáo lâm nghiệp: "A comparison of two modelling studies of environmental effects on forest carbon stocks across Europe" ppsx

... Calculated These Values Are Plotted against the latitude of the centroid of the country in Figure NEP becomes less at higher latitude but the effect is confused by the effect of the different age structure ... flow of litter-nitrogen from trees to soil Taken together, this means that total litter production is not enhanced much but its quality, i.e nitrogen content, is These results are consistent with ... Figure The country data can also be used to show the effect of latitude on productivity For a subset of the countries in Table IV the mean net ecosystem productivity of the cells falling within Their...

Ngày tải lên: 08/08/2014, 00:22

13 327 0
Báo cáo y học: "Comparison of two protective lung ventilatory regimes on oxygenation during one-lung ventilation: a randomized controlled trial" pps

Báo cáo y học: "Comparison of two protective lung ventilatory regimes on oxygenation during one-lung ventilation: a randomized controlled trial" pps

... contraindication The position of the tube was confirmed by auscultation and fiberoptic bronchoscopy before and after turning the patient to the lateral decubitus position Initially, TLV with ... adjusted to maintain ETCO2 of 25 to 30 mmHg After 30 the ventilator was changed to VCV with a VT mL/kg, PEEP of cm H2O, and the ventilator frequency adjusted to maintain a ETCO2 of 25 to 30 mmHg Blood ... distributed parametric values Categorical variables were tested using c2 test or, when appropriate, Fisher’s exact test Statistical significance was accepted at p < 0.05 Results Forty-one patients were...

Ngày tải lên: 10/08/2014, 09:22

5 360 0
Báo cáo y học: "Bone healing after median sternotomy: A comparison of two hemostatic device" pdf

Báo cáo y học: "Bone healing after median sternotomy: A comparison of two hemostatic device" pdf

... distribution Students T- test was applied on PQ-CT density-data to test for differences between treatment groups Mann-Whitney rank sum test was used for the X-ray- and histology data as well as the ... possible that these might catch up to the pigs treated with Ostene® at some later time point However, since the control animals depicted total sternal healing after weeks no doubts can be raised that ... bone density does not necessarily predict the sternal stability or strength of the bone It would be of interest to examine the mechanical strength of the bone Other surgical specialties have...

Ngày tải lên: 10/08/2014, 09:23

8 373 0
Báo cáo y học: "Comparison of two percutaneous tracheostomy techniques, guide wire dilating forceps and Ciaglia Blue Rhino: a sequential cohort study" docx

Báo cáo y học: "Comparison of two percutaneous tracheostomy techniques, guide wire dilating forceps and Ciaglia Blue Rhino: a sequential cohort study" docx

... after dilation of the trachea and the cannula could not be inserted In another patient, arterial blood was aspirated and the procedure was terminated In two patients, the trachea was difficult ... skin and trachea was too large for the insertion of a cannula In the CBR group two patients underwent surgical tracheostomy: in one patient the trachea was difficult to locate, and the cannula ... treatments in the intensive care unit (such as sedation or physical therapy) Moreover, both patients and caregivers often interpret late complications subjectively The total number of late complications...

Ngày tải lên: 12/08/2014, 20:20

7 347 0
Báo cáo y học: " Low NO bioavailability in CCl4 cirrhotic rat livers might result from low NO synthesis combined with decreased superoxide dismutase activity allowing superoxide-mediated NO breakdown: A comparison of two portal hypertensive rat models wit

Báo cáo y học: " Low NO bioavailability in CCl4 cirrhotic rat livers might result from low NO synthesis combined with decreased superoxide dismutase activity allowing superoxide-mediated NO breakdown: A comparison of two portal hypertensive rat models wit

... model The iNOS protein content was below the limit of detection in livers of healthy controls and the two groups with portal hypertension (Fig 2B) The nNOS protein was http://www.comparative-hepatology.com/content/2/1/2 ... University of Leuven, Belgium, and of the University of Berne, Switzerland Authors' contributions MV and JV carried out this study together with the statistical analysis FN participated in the design ... More important than eNOS protein amounts, is the understanding of eNOS enzymatic activity [18] The eNOS activity is inhibited by protein-protein interaction of caveolin-1 with eNOS in hepatic [7,12]...

Ngày tải lên: 13/08/2014, 13:20

8 216 0
w