collection cd4 t cell counts and plasma viral load

Báo cáo y học: " Revisiting HIV-1 uncoating" doc

Báo cáo y học: " Revisiting HIV-1 uncoating" doc

... and the synthesis of the minus strand DNA with concomitant degradation of the RNA template In the HIV-1 genome, two polypurine tracts (PPT), the central PPT (cPPT) and 3’ PPT, resist degradation ... initiation in two distinct sites leads to a displacement of the downstream strand over ca 100 nucleotides, terminating at the CTS and thus generating a discrete strand displacement called the ... fact detrimental to both and is the molecular cornerstone for potent species-specific retroviral restrictions This suggests that the stability and integrity of HIV-1 capsids during the early steps...

Ngày tải lên: 13/08/2014, 01:20

10 247 0
Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction

... mutiplex RT-PCR pha t hiê ̣n virus cúm A/H5N1 bảng: Mồ i Trình t ̣ 5’-3’ Vị trí Tm DiagMF GTCTTCTAACCGAGGTCGAAAC 5-26 55.1 DiagMR GTGACAGGATTGGTCTTGTCTT 158-139 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC ... AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 DiagN1R GCATCAGGATAACAGGAGCA 794-775 55.4 Kích thước 154 bp 371 bp 292 bp T i ... vào plasmid pJET1.2/blunt (Fermentas) t o plasmid t i t hợp, sau đó tiế n hành t ̉ ng hơ ̣p RNA với bô ̣ sinh phẩ m TranscriptA id™ T7 High Yield Transcription Kit (Fermentas) Nồ ng đô...

Ngày tải lên: 10/02/2014, 20:39

11 582 0
Báo cáo khoa học: Ribonuclease H: properties, substrate specificity and roles in retroviral reverse transcription ppt

Báo cáo khoa học: Ribonuclease H: properties, substrate specificity and roles in retroviral reverse transcription ppt

... reverse transcriptase is also a critical primer grip residue that not only interacts with the DNA strand, but also contacts the RNA strand at positions )2 and +1 Mutagenesis studies indicate that Gln475 ... generates the primer for plusstrand initiation [8] Underscoring the importance of this specific cleavage event is the fact that the initiation site of the plus-strand DNA determines the left end ... doublestranded DNA product that is integrated into the host cell genome and ultimately serves as a template for the production of more genome RNAs [79,80] The RNase H activity of reverse transcriptase...

Ngày tải lên: 30/03/2014, 02:20

11 296 0
Báo cáo sinh học: " Quantitative assessment of the effect of uracil-DNA glycosylase on amplicon DNA degradation and RNA amplification in reverse transcription-PCR" pdf

Báo cáo sinh học: " Quantitative assessment of the effect of uracil-DNA glycosylase on amplicon DNA degradation and RNA amplification in reverse transcription-PCR" pdf

... concentration, temperature and time-dependent effect on quantitative RT-PCR sensitivity and DNA degradation Conditions were optimized so that minimal effects on target RNA amplification sensitivity ... quantitative assay sensitivity for RNA detection has not been investigated to date Nor has a quantitative assessment of the concentrations of contaminating DNA that can be degraded prior to RT-PCR ... RT-PCR Given the relatively long time required for the reverse transcriptase step, a heat-labile UNG that is rapidly and effectively inactivated at temperatures below that of the RT step must...

Ngày tải lên: 19/06/2014, 08:20

8 678 0
Báo cáo hóa học: " A broad spectrum, one-step reverse-transcription PCR amplification of the neuraminidase gene from multiple subtypes of influenza A virus" pdf

Báo cáo hóa học: " A broad spectrum, one-step reverse-transcription PCR amplification of the neuraminidase gene from multiple subtypes of influenza A virus" pdf

... influenza at AAHL, helped to draft and edit the manuscript, and participated in the overview of the study RB conceived of the study, and participated in its design and coordination, helped to draft the ... Innovations Pty Ltd that relates to the content of the manuscript BioChip Innovations Pty Ltd is financing the processing charge of this manuscript Authors' contributions ACA designed the primers and ... conferring resistance to antiviral drugs The prompt availability of this information is important for initiating an appropriate treatment and for the tracing and management of outbreaks Methods Design...

Ngày tải lên: 20/06/2014, 01:20

11 378 0
báo cáo hóa học:" Quantitative assessment of the effect of uracil-DNA glycosylase on amplicon DNA degradation and RNA amplification in reverse transcription-PCR" ppt

báo cáo hóa học:" Quantitative assessment of the effect of uracil-DNA glycosylase on amplicon DNA degradation and RNA amplification in reverse transcription-PCR" ppt

... concentration, temperature and time-dependent effect on quantitative RT-PCR sensitivity and DNA degradation Conditions were optimized so that minimal effects on target RNA amplification sensitivity ... quantitative assay sensitivity for RNA detection has not been investigated to date Nor has a quantitative assessment of the concentrations of contaminating DNA that can be degraded prior to RT-PCR ... RT-PCR Given the relatively long time required for the reverse transcriptase step, a heat-labile UNG that is rapidly and effectively inactivated at temperatures below that of the RT step must...

Ngày tải lên: 20/06/2014, 04:20

8 475 0
Báo cáo hóa học: "Rapid detection of sacbrood virus (SBV) by one-step reverse transcription loop-mediated isothermal amplification assay" pptx

Báo cáo hóa học: "Rapid detection of sacbrood virus (SBV) by one-step reverse transcription loop-mediated isothermal amplification assay" pptx

... Length 21-nt 18-nt 46-mer(F1c:25-nt, F2:21-nt) 44-mer (B1c:22-nt, B2:22-nt) 23-nt 23-nt Sequence(5′ to -3′) AAGGAACTATAGTATGGCGAA CTGTTGCTGGTCTCTTGT TGGACCTACAAATTGCACCAATATAACCTCTTACAGTTGCAAAGTG ... TGGACCTACAAATTGCACCAATATAACCTCTTACAGTTGCAAAGTG AAGGACCCAGAGTGATGAGGTATGTATTTTCTTCCTTGGAACTT CTCTTAGCTGCTAGTTCTGAAGC CCCTCGAAAGAATCTATTCAGGG The RT-LAMP assay successfully amplified the target sequence of the SBV-pol gene, as observed ... in the field Competing interests The authors declare that they have no competing interests Authors’ contributions JY, YR and KS carried out most of the experiments and wrote the manuscript, and...

Ngày tải lên: 21/06/2014, 19:20

9 266 0
Báo cáo khoa học: "TaqMan reverse transcription polymerase chain reaction for the detection of Japanese encephalitis virus" pot

Báo cáo khoa học: "TaqMan reverse transcription polymerase chain reaction for the detection of Japanese encephalitis virus" pot

... probe The detection limit of the real-time RT-PCR was calculated to be 11.2 TCID50/ml (Table 2) This result of detection limit was similar to that of the previous study [12] The conventional method ... Probe3 GGTGTA AGGACTAGA GGTTAG AGG ATTCCC AGGTGTCAATATGCTGTT 6Fam-CCCGTGGAAACAACATCATGCGGC-Tamra 10,726-10,750 10,848-10,871 10,754-10,777 3' NTR 146 bp *Nucleotide sequence position according to KV1899 ... extracted viral RNA from the JEV infected culture supernatants were analyzed to define the sensitivity of tests The results showed that real-time RT-PCR proved to be 10fold more sensitive than conventional...

Ngày tải lên: 07/08/2014, 18:20

7 334 1
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps

Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps

... '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 '3-CTGAARATGGGKACCTGCG-'5 '3-GTSCGYTTSTGYCGCACAA-'5 '3-px CCATGGACTTCCCGTAGGAATCGGACAm-'5 ... eht ,sloot citsongaid rehto yb esoht htiw RCP-TR T/ R yb deniatbo stluser eht erapmoc oT 05 stset rehto dna RCP-TR T/ R fo timil noitceted eht fo nosirapmoC evitagen deredisnoc saw elpmas eht ,selcyc ... RCP-TR T/ R ehT ASILE-gA yb detset nehw devresbo saw noitceted negitna on saerehw ,lm/ DICT 01 fo noitartnecnoc ANR lariv eht saw RCP-TR lanoitnevnoc eht fo timil noitceted ehT RCP -TR T/ R eht ni...

Ngày tải lên: 07/08/2014, 18:21

6 347 0
Báo cáo y học: "Investigation of infectious agents associated with arthritis by reverse transcription PCR of bacterial rRNA" ppsx

Báo cáo y học: "Investigation of infectious agents associated with arthritis by reverse transcription PCR of bacterial rRNA" ppsx

... AGTAGTTTACTACTTTGCCG ACTGCTGCCTCCCGTAGGAG Universal (R1 and R2) 58°C/60 secs 1.5 350 CATAACGTCGCAAGACCAAA GTGCAATATTCCCCACTGCT E coli 58°C/45 secs 1.5 187 TTGGGAATAACGGTTGGAAA TGTCTCAGTCCCAGTGTTGG ... CGCACGGGTGAGTAAGGTA GCGTCATAGCCTTGGTAAGC Campylobacter spp 66°C/1 2.5 170 AGTAGTTTACTACTTTGCCG CCGATGGCGTGAGGCCCTAA Yersinia spp 65°C/30 secs 3.5 154 CGCACGGGTGAGTAAGGTA GCTTAACACAAGTTGACTAG Campylobacter ... the untreated samples SF from patient C was the only sample that tested positive without DNase treatment and negative following DNase treatment, indicating that bacterial 16S DNA was most likely...

Ngày tải lên: 09/08/2014, 01:21

8 310 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

... corrected quantity of CD4 and CD8 mRNA as determined by QC-RT-PCR and the corresponding CD4 and CD8 counts of that patient as determined by flow cytometry are depicted in Table The patients' HIV status, ... of quantifying mRNA levels We therefore set out to develop an RT-PCR based method to quantitate CD4 and CD8 mRNA in the hopes that this could be used to predict cell counts Although it has long ... QC-RT-PCR and related techniques such as real-time PCR are not useful as substitutes for assessment of CD4 and CD8 cell status in HIV-infection by flow cytometry Methods QC-RT-PCR The strategy for...

Ngày tải lên: 11/08/2014, 08:20

4 319 0
Báo cáo y học: " Variability in a dominant block to SIV early reverse transcription in rhesus monkey cells predicts in vivo viral replication and time to death" pot

Báo cáo y học: " Variability in a dominant block to SIV early reverse transcription in rhesus monkey cells predicts in vivo viral replication and time to death" pot

... early RT forward, 5'-AAGCAAGTGTGTGTTCCCATCT-3'; early RT reverse, 5'-CCTCGGTTTCCCAAAGCAGAA-3'; late RT forward, 5'-AAGCAAGTGTGTGTTCCCATCT-3'; late RT reverse, 5'-CACTTACCTGCAACCGGAGG-3'; integrated ... 5'-GCTGCCGATTGGGATTTACAAC3'; integrated reverse, 5'-AATGTCTGATCCTCTTGGCTCTC-3' Quantification was performed with an Applied Biosystems 7300 real-time PCR system (Foster City, CA) GAPDH control ... replication is critically important to aid in our design and implementation of preventative and therapeutic interventions to reduce HIV acquisition and viral burden Competing interests The authors...

Ngày tải lên: 12/08/2014, 04:20

11 340 0
Báo cáo y học: " A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus" pptx

Báo cáo y học: " A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus" pptx

... CAV, RV, and uninfected cells control, indicating the high specificity of the method The method was sensitive, in that it could detect as little as 0.1 TCID50 of the virus The selected two samples ... strains: Onderstepoort, Convac, A75/17, Rorkborn, Snyder Hill, Lederle, et al) Forward primers P1 (5'-AAATCCTGTGTTACCCGCTC-3'), P2 (5'-TGGTGGCTCTGCAATATGAA3'), and P3 (5'-AATGAATGGATGCCTGGGGTTT-3') were ... developed in this study is a highly specific and sensitive assay for the rapid detection and differentiation of wild-type and vaccine strains of CDV Competing interests The authors declare that they...

Ngày tải lên: 12/08/2014, 04:20

6 481 0
Retrovirology Review BioMed Central Open Access When is it time for reverse transcription to docx

Retrovirology Review BioMed Central Open Access When is it time for reverse transcription to docx

... NC contribute to the maintenance of the complete viral DNA and its IN-mediated integration into the host genome during the course of cell infection [45,79,80] Future prospects One outstanding ... to better understand, at the molecular level, the multiple interactions between NC, RT, and the viral nucleic acids that ensure fidelity and completion of viral DNA synthesis (reviewed (A) WT ... infected cells up to the nuclear pore [50-54] These results strongly suggest that completion of proviral DNA synthesis most probably relies on the proper structure and the stability of the viral...

Ngày tải lên: 12/08/2014, 23:20

9 353 0
Báo cáo y học: " The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro" doc

Báo cáo y học: " The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro" doc

... analysis of these putative RT-host protein interactions are important for a thorough understanding of viral replication and for drug discovery efforts that target HIV-host protein interactions The present ... T/ P substrates that contain AREs and bound both HIV-1 RT and HuR (Fig 4B) Therefore, our results suggest that HuR does not interfere with HIV-1 replication through a direct interaction with the ... dNTP additions [21,22] Importantly, this template does not contain AREs that would interfere with HuR binding to the RNA (data not shown) DNA synthesis reactions carried out with this T/ P in the...

Ngày tải lên: 12/08/2014, 23:23

7 258 0
Báo cáo y học: "Subtype-associated differences in HIV-1 reverse transcription affect the viral replication" ppt

Báo cáo y học: "Subtype-associated differences in HIV-1 reverse transcription affect the viral replication" ppt

... (5’-ACAGTATGATCAGATACTCATAGAAATCTGCGG-3’) containing BclI restriction enzyme site and reverse primer polCR2 (5’ATACTCCATGTACCGGTTCTTTTAGAA-3’) with an introduced AgeI site Identical fragments from ... (5’-AAATTGCAGGGCCCCTAGGAAAAAGGGCTGTTG-3’), containing a PspOMI restriction enzyme site, and 2992p51R (5’-GCCTCTGTTAACTGTTTTACATCATTAGTG TGG-3’) with an introduced HpaI site, were used for PCR amplification of the NL4-3 ... RTage1F (5’-TAAAAGAACCGGTACATGGAGT-3’) with an introduced AgeI site and reverse primer polEcoR1R (5’-TTGTTGCAGAATTCTTATTAT-3’) containing the EcoRI restriction enzyme site After subcloning into...

Ngày tải lên: 13/08/2014, 01:20

18 291 0
Báo cáo y học: " Blocking premature reverse transcription fails to rescue the HIV-1 nucleocapsid-mutant replication defect" ppsx

Báo cáo y học: " Blocking premature reverse transcription fails to rescue the HIV-1 nucleocapsid-mutant replication defect" ppsx

... D shows the titer of the PEG-precipitated WT virus, with the treatments (indicated at the bottom) normalized for the gRNA present in the starting supernatant (i.e., corrected for dilution) Values ... upon RTI treatment with the NC mutants The relative difference in the titers of NCWT to that of the NCmutants is what we normally see when viruses are not PEG precipitated ([28]; data not shown) ... relationship between intravirion DNA and infectivity by testing whether the NCWT or NCmutant phenotypes were dominant We cotransfected cells with different ratios of NC WT and NC mutant proviral...

Ngày tải lên: 13/08/2014, 01:20

14 221 0
Báo cáo y học: "Isolated HIV-1 core is active for reverse transcription" pptx

Báo cáo y học: "Isolated HIV-1 core is active for reverse transcription" pptx

... ELISA and the ability to generate authentic reverse transcription products (endogenous reverse transcription or ERT activity) Interestingly, with repeated attempts we were not able to detect ERT ... ERT activity than fraction These three peak fractions represented 6% of total ERT activity of the fractions This core fraction was capable of first-strand transfer, and fulllength minus strand ... fractions with capsid and ERT activity which most likely contain biochemically active cores We are the first to report the detection of authentic strongstop, first-strand transfer and full-length...

Ngày tải lên: 13/08/2014, 05:22

5 302 0
Báo cáo y học: "Early and transient reverse transcription during primary deltaretroviral infection of sheep" ppt

Báo cáo y học: "Early and transient reverse transcription during primary deltaretroviral infection of sheep" ppt

... C TC C A A G G G C G T C T T G T4 32C T/ C TC C A A G G G C G T C T/ C C G G C T T G T8 617C BLV provirus TG TCT T A C T T 3’ LTR C TG T T G TTT C C T4 66C TG TCT T A C T T T/ C G TT T C C T/ C 5’ LTR ... 5'GCTTTGCAGAAGGTTGAGCC-3') and the 3' counterpart (BLV-tax 5'-ACCTGGTCCGAATTGGTTGC-3' and BLVU5as 5'-GTTTGCCGGTCTCTCCTG-3') respectively For the amplification of the GAPDH gene, the primers G3PDHS ... genetic variation that parallel their twostep nature of replication over time [6] and correspond to RT-associated rearrangements and somatic mutations The former appears restricted to the first...

Ngày tải lên: 13/08/2014, 06:20

12 217 0
Báo cáo y học: " Contribution of the C-terminal tri-lysine regions of human immunodeficiency virus type 1 integrase for efficient reverse transcription and viral DNA nuclear import" pps

Báo cáo y học: " Contribution of the C-terminal tri-lysine regions of human immunodeficiency virus type 1 integrase for efficient reverse transcription and viral DNA nuclear import" pps

... codon (ATG) was placed prior to the first amino acid (aa) of IN The primers are 5'-IN-HindIII-ATG (5'-GCGCAAGCTTGGATAGATGTTTTTAGATGGAA-3') and 3'-IN-Asp718 (5'-CCATGTGTGGTACCTCATCCTGCT-3') The PCR ... underlying the action of these IN mutants during HIV-1 DNA nuclear import Conclusion Taken together, the results presented here highlight that all three C-terminal mutants tested in this study resulted ... nucleus-associated viral DNA (Fig 5C) It suggests that these IN mutants may also negatively affect viral integration during their infection Alternatively, it could be possible that these mutants may...

Ngày tải lên: 13/08/2014, 09:21

15 417 0
w