coli rnase e and rnase g

... GGGGGATCCCCATAATCCACTCCACCTGCTAAA GGGGGGGATCCT CATTATTTCCCTTCT AATACCGCCATGTATAATATCTATTACTTC GTAATAGATATTATACATGGCGGTATTGAA GGGGGGGCCATGGAAAGAGCAGACGATTT Large-scale protein expression and purification Cultures were grown ... Table PCR primer names and sequences Primer name Sequence 21 33 40 41 44 66 67 75 GGGTCTAGAATGGAAAAAGATCTACAGTTAAGA CCGGAATTCTTATTTCCCTTCTCTCATCTC GCGCGCCATGGAAAAAGATCTACAGTTAAGA GGGGGATCCCCATAATCCACTCCACCTGCTAAA ... nucleotide sequence of the ora genes in order to facilitate the amplication by PCR An NcoI site was introduced into the start of the oraS gene and a BamHI site into the end of the oraE gene Genomic...

Ngày tải lên: 30/03/2014, 15:20

... The epitope and the antibodies directed against it have been characterized; this subject has been reviewed recently [5] Although we have a detailed understanding of how endotoxins act on immune ... acid was used as reference (set to d p.p.m.) All spectra were recorded at a temperature of 300 K and standard Bruker pulse programs were used in all experiments Spectra were recorded from a solution ... centrifugation and separation as before, the extraction of the phenol phase was repeated again The water layers were combined, dialyzed against water and lyophilyzed (yield 1.55 g) , then extracted...

Ngày tải lên: 20/02/2014, 23:20

... used for generating monospecific antibody) was included during the BLAST operation (sequence can be seen underlined in the figure) This peptide was selected from the CatE sequence using laser gene ... distinguishes between the activities of the enzymatically similar proteinases, CatE and CatD, and can therefore be used to investigate the involvement of these enzymes in antigen processing and presentation ... results of indirect ELISA (Fig 2B) showed that the antibody specifically recognized CatE and the antigenic peptide SRFQPSQSSTYSQPG used to generate the antibody, and gave a complete negative reaction...

Ngày tải lên: 07/03/2014, 09:20

... reduced pressure at room temperature until ethanol and methanol were removed followed by drying in a freeze-dryer The dry extracts (extractable phytochemicals) represented 24.8% of the rice germ and ... broken germ generated from the rice milling process Only one vitamin E component, γ-tocotrienol, was found in FFRB at the level of 106.01 mg/kg Other vitamin E components were not detected in the ... 320 and 290 nm (Figure 2), they were more sensitive at the 320 nm wavelength The 320 nm peaks were used to quantitate γ-oryzanol components The results shown in Figure and Table indicate a significant...

Ngày tải lên: 15/03/2014, 15:33

... the mutants lacking the propeptide and most of the ER-retention sequence (B, C) The transfected cells expressing the mutants lacking the propeptide (Dpro) (B) and the ER-retention sequence (DER-ret.) ... chimeric proteins between cathepsin E and pepsinogen in Fig Pulse–chase analysis of the mutants lacking the propeptide and ER-retention sequence (A) Schematic representation of the structures ... Dulbecco’s modified Eagle’s medium (DMEM) containing unlabeled methionine for different periods of time up to 24 h At the end of the chase, cells and culture media were collected separately The cell...

Ngày tải lên: 16/03/2014, 14:20

... effacement-encoded type III secretion system and attaching ⁄ effacing lesions To promote interactions with the intestinal epithelium and generate actin pedestals, EPEC and EHEC utilize specialized ... the the locus of enterocyte effacement (LEE), which is present in all attaching ⁄ effacing bacteria including EPEC and EHEC The LEE also encodes transcriptional regulators, chaperones and several ... interactions between Tir and EspFU Tir and EspFU are the only two EHEC effectors required for pedestal formation, because clustering of Tir in the presence of EspFU (and in the absence of all other effectors)...

Ngày tải lên: 29/03/2014, 09:20

... the longer spacers, especially with a 12 base spacer, gave higher gene expression in the infA mutants Comparison of two different reporter gene systems Relevant reporter gene sequences were also ... and some sequence signals in the TIR region We decided to analyze these signals Effect of the downstream region composition The influence of different sequences downstream of AUG on gene expression ... normal genes are unaffected by the IF1 alterations, thus resembling the 2A¢ gene Some genes, however, show increased expression, being similar to 3A¢, and others show decreased expression Kasugamycin...

Ngày tải lên: 29/03/2014, 09:20

... virus genome and the genetic elements fused to EGFP gene (B) Growth of recombinant YF17D/DEN4 viruses in Vero cells Three independent experiments were performed to measure viral spread in Vero cells ... one located just upstream of the EGFP gene, corresponding to the stem anchor of the dengue E protein gene, and the second one located just downstream of the EGFP gene, corresponding to the stemanchor ... only the replacement In this regard short sequences encoding known B and T cell epitopes, have been inserted in the intergenic region between NS2B-NS3 and at a selected site of the E gene [6,8,10,11]...

Ngày tải lên: 18/06/2014, 18:20

... virus genome and the genetic elements fused to EGFP gene (B) Growth of recombinant YF17D/DEN4 viruses in Vero cells Three independent experiments were performed to measure viral spread in Vero cells ... one located just upstream of the EGFP gene, corresponding to the stem anchor of the dengue E protein gene, and the second one located just downstream of the EGFP gene, corresponding to the stemanchor ... only the replacement In this regard short sequences encoding known B and T cell epitopes, have been inserted in the intergenic region between NS2B-NS3 and at a selected site of the E gene [6,8,10,11]...

Ngày tải lên: 20/06/2014, 01:20

... disseminating the results of biomedical researc h in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed ... suggest the existence of exogenous and/ or endogenous synchronizers, as observed for other hematochemical parameters Further studies involving experimental manipulation of feeding time and ration quality ... D, E and K in the horse, with diurnal acrophases The observation of acrophases included between 15:16 and 18:08 during the experimental period for all the vitamins studied could suggest the existence...

Ngày tải lên: 10/08/2014, 09:20

... average weaning age was 34.9 days The average weaning age in the entire In-gris litter recording system in the same year was 35.0 days [13] When herd was excluded, differences between litters ... weaning period Materials and methods Herds and feeding Six normal pig breeding herds were selected for the study Only herds registered in In-Gris, the Norwegian litter recording system [13], were ... assess In feeding trials with different vit E and Se levels, effects on daily weight gain and other performance parameters are generally not observed [8] No special disease problems were seen...

Ngày tải lên: 12/08/2014, 18:21

... Massachusetts Medical Society All rights reserved The New England Journal of Medicine Downloaded from nejm.org on January 6, 2013 For personal use only No other uses without permission Copyright ... All rights reserved The New England Journal of Medicine Downloaded from nejm.org on January 6, 2013 For personal use only No other uses without permission Copyright © 1994 Massachusetts Medical ... Society All rights reserved The New England Journal of Medicine Downloaded from nejm.org on January 6, 2013 For personal use only No other uses without permission Copyright © 1994 Massachusetts...

Ngày tải lên: 23/05/2016, 10:05

... of water transparency on UV disinfection e ciency This minus e ect is usually estimated by considering UV dose decreases in the target water UV dose decreases are estimated by determining UV absorbance ... may also be affected by water transparency, and the e ect may be estimated by similar method used for estimation of UV dose decreases in water The difference between inactivation and photoreactivation ... suspended about 15 cm above the liquid surface A beaker containing the UV-treated bacterial suspension mixed with a magnet bar was placed on a magnetic stirrer Samples were taken after timed intervals...

Ngày tải lên: 05/09/2013, 08:40

... their nonbridging oxygens Sulfonamide-linked nucleosides were employed rst in antisense technology, where they were found to be highly soluble, and resistant to both enzyme-catalyzed and nonenzymatic ... chemicals and biochemicals were of reagent grade or better, and were used without further purication Compounds 13 [49,50] and 47 [51] were synthesized as described previously, and were generous gifts ... Pizzo E & DAlessio G (2007) The success of the RNase scaffold in the advance of biosciences and in evolution Gene 406, 812 Rosenberg HF (2008) RNase A ribonucleases and host defense: an evolving...

Ngày tải lên: 14/02/2014, 22:20

... Five N-terminal residues and loop 62–68 were removed from the superposition, owing to high flexibility These segments were determined well only in molecules where they were stabilized by a neighboring ... several cycles of refinement, and their presence was confirmed by a decrease in R and Rfree In the final stages, the complex structures were refined using TLS Temperature factors, bond lengths and ... 3DH2) were selected for docking All nonprotein molecules (nucleotides, sulfates, glucoses, and waters) were removed, and input files containing protein molecules were preprocessed using the Protein...

Ngày tải lên: 18/02/2014, 11:20

... comparable with the volume of a methylene group The side-chain of Met is larger than that of Val, and the difference between them is equivalent to one methylene group in size Therefore, the decrease ... figure as a reference Relatively large shifts were observed around Gly17 and Asn18 in a turn between the bA and bC strands, around Ser95 in a loop between the aIII and aIV Fig Stereoview of the ... constructed in our laboratory Mutagenesis The genes encoding R9 7G -RNase HI, D136H -RNase HI, 5· -RNase HI and 6· -RNase HI were constructed by sitedirected mutagenesis using PCR as described previously...

Ngày tải lên: 18/02/2014, 13:20

... carried out using forward primer 5¢-CCGCTGGCGCATG GCGGGTAGG-3¢ and reverse primer 5¢-GGGGTGGGCC TCAGGGCTGGG-3¢ Then nested primers 5¢-GTCTGA GCTATGAGTGGCCC-3¢ (forward) with a restriction site for ... normalized to reference genes: elongation factor (EF-2), 5¢-GACATCACCAAGGGTGTGCA-3¢ (forward) and 5¢-TTCAGCACACTGGCATAGAGGC-3¢ (reverse); GAPDH, 5¢-CCGAGCCACATCGCTCAGAC-3¢ (forward) and 5¢-GTTGAGGTCAATGAAGGGGTC-3¢ ... upper band) At this stage of the study, the following hypothesis may be presented: some overexpressed IL-1b is secreted and stimulates the endogenous form of MCPIP, resulting in the observed higher...

Ngày tải lên: 18/02/2014, 14:20

... contains three RNase H-like genes [26] Beacuse no organism whose genome contains three active RNase H genes has been reported before, it is also important to note whether the three genes of S coelicolor ... containing the gene As expected, the SCO2299 gene suppressed the ts growth defect, suggesting that the SCO2299 protein was an RNase H enzyme Its N-terminal and C-terminal regions were cloned independently ... 3¢-primer for the full length gene; the 5¢-F primer as 5¢-primer and 5¢-GGCGCGAGATCTTTATTACGC GTCGAGCTCCGCCGTCGAGTC-3¢ as 3¢-primer for the RNase H domain; and 5¢-GGGCCGCCCCATATGGG CGCCCCCGCGACCTTC-3¢...

Ngày tải lên: 19/02/2014, 18:20

... substrate Experiments were carried out at least twice and the average values are shown together with the errors RNase HI These results indicate that removal of the HBD severely reduces the Mg2+-dependent ... substrate Experiments were carried out at least twice and the average values are shown together with the errors activities decreased to a large extent at higher (‡ 0.2 m) salt concentrations When the ... temperature-sensitive growth phenotype [28] E coli MIC3001(DE3) also displays this phenotype To examine whether the genes encoding Tma -RNase HI and Tma-CD complement the temperature-sensitive growth...

Ngày tải lên: 06/03/2014, 22:21

... the role played by the hinge and interface regions in the swapping process, we prepared BS -RNase variants by replacing Pro19 and Leu28 with the corresponding residues from RNase A Here we report ... the mutant P19AmBS The amplified, mutated genes were separated, excised, and purified from the agarose gel followed by cloning into pET-22b(+) between the HindIII and NdeI sites Insertion of the ... experiments, 5¢-GAGTGCGGCC GCAAGCTTGGGCTG-3¢, had an estimated Tm of 82 °C The reverse flanking primer sequence, 5¢-ATATACA TATGAAAGAAAG-3¢, had a calculated Tm of 42 °C The mutagenic primers for each...

Ngày tải lên: 16/03/2014, 23:20