... populations of oribatid (cryptostigmatid) and prostigmatid mites, and root- and fungal-feeding, omnivorous and predaceous nematodes (Sohlenius and Wasilewska, 1984) Numbers of root-feeding nematodes ... stimulate microbial growth and enhance decomposition and nutrient immobilization (Seastedt, 1984) However, nutrient mineralization rates are relatively slow with stratification of debris and soil; ... nematodes and astigmatid mites (Andrén and Lagerlöf, 1983; Yeates, 1984; Hendrix et al., 1986; Beare et al., 1992) and are considered in an early stage of succession Oribatid and mesostigmatid...
... water proof sheet to water comprehend the water balance Water that penetrates Infiltrated through the soil is gathered at the bottom of the water Soil penetration facility 24. 5m2×2 facility and ... (cm) Akadama sand (5) Pit sand (40) Pit sand (45) Journal of Water and Environment Technology, Vol.3, No.2, 2005 water and Overflow water were measured by a flow meter In addition, water quality ... between values estimated by the model and values measured by water quality survey and flow rate survey is shown in Figure 13 20000 Estimated value (L) (L) Estimated vslues Infiltrated water volume,...
... better understanding of the significance of the different degrees of chromatin condensation and chromatin modification that prevail in the nucleus, that enable the appropriate activation of specific ... nucleosomes at a : molar ratio in place of histone H1 and, like H1, it promotes chromatin condensation [110] In this context, PARP-1 does not PARylate chromatin, and activation of its enzymatic activity ... factors and chromatin lies in the concentrated effect of multiple factors that cooperate in the destabilization of chromatin at specific sites located close together Part of this cooperativity...
... regulates the dendrite arborization patterns that are critical for shaping neuronal circuits, and also may provide a clue to the understanding of some MAP2-associated neurodegenerative and psychiatric ... leupeptin and mm phenylmethanesulfonyl fluoride) After centrifugation at 1000 g for 10 at °C, the supernatants were mixed with the antibody and incubated on ice for h, followed by rotation with ... (Fig 5B) These results suggest that KIND2 and KIND2-1, overexpressed in neurons, act as dominant-negative regulators of v-KIND and suppress the negative regulation of dendrite growth by endogenous...
... population growth rate: the maximal rate, rmax, and the rate of turnover at steady state Data on rmax for a wide variety of organisms, from unicellular eukaryotes to invertebrates and vertebrates, ... structure and dynamics of aquatic ecosystems Metabolic rate, and other rate processes controlled by metabolic rate, are strongly affected by both body size and temperature We can ‘correct’ for variation ... temperature-corrected using the Boltzmann factor, eÀE/kT, following Eq (1.2) Data and analyses from Savage et al (2004b) other extrinsic factors, but birth and death rates must match, and the rate...
... cells, and the androgen-independent prostate cancer PC3 and DU145 cells (Fig 2)], indicating that Noxo1c regulates Nox1 in co-operation with Noxa1 in a single cell In PMA-stimulated cells, Noxo1c and ... pepstatin A, 20 lgÆmL)1 chymostatin, and lysed by three rounds of 5-s sonication The sonicates were centrifuged for 10 at 10 000 g, and the supernatant was further ultracentrifuged for 45 at 100 ... PI5P, phosphatidylinositol 5-phosphate; PI(3,5)P2, phosphatidylinositol 3,5-bisphosphate; PI(4,5)P2, phosphatidylinositol 4,5-bisphosphate; PI(3,4)P2, phosphatidylinositol 3,4-bisphosphate; PI(3,4,5)P3,...
... responses In tobacco and tomato leaves, an extracellular AP has been implicated in the degradation of pathogenesis-related (PR) proteins These proteins are synthesized and accumulated in the intercellular ... resembles what has been described for mammalian saposin C and cathepsin D It has been suggested that the association of saposin C with cathepsin D may be responsible for the mannose-6-phosphate independent ... a peptide signal [24] Plant senescence and programmed cell death (PCD) The specific accumulation and maximum activity of cyprosins in mature flowers of C cardunculus L may indicate a role of these...
... rat a3b4 nAChRs with a nAChR populations labelled by the relatively nonselective relatively low affinity (IC50 value of 750 nM) and is at least nAChR ligand [3H]epibatidine It was suggested that ... an amidated C-terminus To investigate the influence of these postranslational modifications on potency and subtype selectivity, its nonamidated and nonsulfated analogues were synthesized and characterized ... a-conotoxins in the determination of the structure and function of native nAChRs, and indicate that selectivities and potencies found on oocyte-expressed nAChRs can be extrapolated to native systems There...
... such that a Ser is inserted at the corner opposite the TXT face This may remove the strain on the b-strand at the TXT motif, ensuring that the face remains atand provides a good lattice match ... TmAFP and sbwAFP were measured at 30 °C and °C [38,40] Overall, the results suggest that both proteins are rigid, due to the mostly invariant relaxation data and that lowering the temperature ... ultracentrifugation data [43] Taken together, the data suggest that the oligomerization is observed simply because of the complimentary nature of the repetitive structures and the high concentration...
... 12.8% 1.5% 1.9% 3306 3306 3306 18.7% 2.7% 3.1% 247 1 247 1 247 1 Table 3: Correlations between initial frequency and dissemination over users and threads and a change in frequency for the 851 most common ... template-based affix-stripping preprocessing step, removing common German affixes before feature extraction Because of the possibility of multiple prefixation or suffixation (e.g rum-ge-battle (‘battling ... relative frequency (aggregated over all word forms) in each Covo and MZEE time window We then measure correlation coefficients r between the frequency of a stem in Covo at time Tt , ftE (stem), and...
... has indicated that induced Spatzle expression ¨ is regulated by the Toll pathway but not the Imd pathway [44], suggesting that Spatzle gene expression is not ¨ stimulated by Gram-negative bacteria ... demonstrated that this step effectively separated Spatzle-C108 from its pro-domain and the acti¨ vating proteinases, and that it remained as a disulfide linked homodimer (Fig 7B) M sexta Spatzle-1 ... proSpatzle-1A and Thr119 in proSpatzle¨ ¨ 1B) The putative activation cleavage site, identified by alignment with D melanogaster and B mori proSpat¨ zle (Fig 2), is located after IAQR169 in proSpatzle-1A...
... the relaxation rate experiments and the calculation of standard deviations were accomplished using the nlinls procedure The values of R1 and R2 were then calculated from the table of relative peak ... conformations may also indicate that chaperones and ⁄ or cell translation machinery could facilitate the folding of the C-domain The relative populations of the two protein conformations were found to ... His6-tags E coli BL21(DE3), and purified as described previously [6,13,35] Purification of initiation and elongation factors, ribosomal subunits, and aminoacylation of tRNA Pretermination complexes were...
... hydroxyisourate hydrolase Localisation and implications for function and mechanism Plant Physiol 130, 2061–2068 51 Sarma AD, Serfozo P, Kahn K & Tipton P (1999) Identification and purification of ... A’–C’ are indicated with straight lines and are labelled; b-strands are indicated with arrows and are labelled A–H A single a-helix is indicated with a rectangle The residues that are strongly ... free-radical species, which ultimately contribute to lipid oxidation [27] Given this fact and the observation that only (S)-allantoin is found in nature, Kahn and Tipton [26] proposed the existence...
... mitogenic stimulation by two closely related kinases, S6 kinase (S6K) and S6K2 The strong correlation between the translational activation of TOP mRNAs and the hyperphosphorylation of RPS6 [36] ... degree of growth retardation and malformations Most RPS19 mutations are whole gene deletions, translocations, or truncating mutations (nonsense or frameshift), suggesting that haploinsufficiency ... that alteration of any of the involved RPs can affect the maturation of rRNA [72] Moreover, investigations on the effect of mutations on the synthesis of RPS19 showed that: (a) mutations that affect...
... recognition and specificity [24] ; the four tandem KH domains of P-element somatic inhibitor protein (PSI), for example, bind ligand cooperatively [25] The KH1–KH2 domains of NusA (Protein Data ... of the ligand stacking with each other Coordinates from Protein Data Bank entry 1J5K were used in (A) and (B), and coordinates from Protein Data Bank entry 2ASB were used in (C) C Data Bank entry ... asymmetric unit related by two-fold NCS (Protein Data Bank coordinates 2QND) The strands of one chain are represented as open arrows, and the symmetry-related strands are shaded Hydrophobic and polar...
... firmly bound Materials and methods Enzyme purification R eutropha cells were cultivated heterotrophically at 30 °C in a mineral medium [27] and stored at )70 °C The SH was purified at °C in air ... deficient in FMN-a is inactivated by O2, creating an OH– ligand at nickel, it cannot be reactivated by NADH and so both the H2-NAD+ and H2-BV reactions are absent group can dissociate from the enzyme ... buffer at 30 °C The absorption decrease at 420 nm was monitored using a Zeiss M4 QIII spectrophotometer (e ¼ mM)1Æcm)1 for K3Fe(CN)6 at 420 nm) NADH (1.25 mM) and lL sample were added and later...
... template are underlined Name Sequence C45S C131S 5¢-GGCACAGACCAGAGTGTGGAGAGGATCAATGAG 5¢-GGAACAGGCTCCAACAGTAGGCTTATCAACCC C143S C211S 5¢-GATGGCTCCGAGAGTGGCAGTGGAGGCTGGGG 5¢-CCCATTTGTATAGGGACTTTGATAAAAGTAAG ... C217S 5¢-GCTGGATTTAGTCAGAAAATTGCAGAAGGTG C268S 5¢-CCCATTCTGAGTGTGGGCTCAGTGTGG TGATGG TTTGCTGGATTTTGCCAGAAAATTGC CACATCAGGG 4214 M Berger et al (Eur J Biochem 269) The parental template is then ... both substrates, GlcNAc and ATP were determined for all mutants and for the wild-type enzyme (Table 2) In Table Kinetic data of wild-type and mutated GlcNAc All values are means of at least three...
... which catalyzes cyclization of FPP initiated by the cleavage of its pyrophosphate moiety and formation of a carbocation intermediate (see below for details) [43] The active-site residues Phe77 and ... condensation must be rate limiting because the first reaction of C15 to C20, in which UPPS or OPPS is preincubated with FPP so that the pyrophosphate dissociation and the relocation of the intermediate ... carbocation intermediate at C1–C3 carbons of FPP is formed, and the negative charge developed on pyrophosphate is stabilized by co-ordination with Mg2+ The deprotonated IPP or a Zn2+-activated...
... McHugh, T.E., Atkins, W.M., Racha, J.K., Kunze, K.L & Eaton, D.L (1996) Binding of the aflatoxin-glutathione conjugate to mouse glutathione S-transferase A3–3 is saturated at only one ligand per dimer ... reductase, glutathione synthase, rat GST A1-1 and human GST A1-1, inactivation studies were carried out The pseudo-first-order rates of inactivation observed at a SDTG concentration of 98.2 lM and in ... of native and mutated enzyme (data not shown) indicates the absence of any structural perturbation caused by the mutation Aminoacid analysis of the SDTG-modified Phe51Ala mutant and determination...