... GTT ATT GTG GTA GT-3' mTLR4 lower 5'-TGC CGT TTC TTG TTC TTC CTC T- 3' mTLR6 upper 5'-ATA CCA CCG TTC TCC ATT T- 3' mTLR6 lower 5'-GAC GTG CTC TAT CAT CAG TG-3' FACS sorting, by using a panel of ... upper 5'-GGC ATA CGC CAG TCA AAT A-3' mTLR1 lower 5'-ATG CAG AAA TGG GCT AAC TT-3' mTLR2 upper 5'-TCT GCT GTG CCC TTC TCC TGT TGA-3' mTLR2 lower 5'-GGC CGC GTC GTT GTT CTC GT-3' mTLR4 upper 5'-AGC ... indicated the critical involvement of T cells in the pathogenesis of Lyme disease The fact that human T cells with specificity for a particular OspA epitope in the context of HLA-DR4 protein co- recognize...
Ngày tải lên: 09/08/2014, 01:23
... observed to localize to punctate clusters that formed immediately upon contact and were coincident with sites of tight interactions between the Jurkat T cell and the coverslip [48] These punctate clusters ... localization of individual signaling proteins, but also to quantitatively investigate protein– protein interactions The recruitment and localization of LAT and LAT-binding proteins to the sites of receptor ... shown that the formation of LATmediated signaling complexes play a complex role in the differentiation and homeostasis of T- cell populations, the maturation of B cells and the activation of mast cells...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo y học: "β Susceptibility to collagen-induced arthritis is modulated by TGFβ responsiveness of T cells" ppt
... impaired TGFβ-signalling in T cells than in wild-type littermates These results demonstrate that endogenous TGFβ acts on T cells to maintain joint integrity after the induction of arthritis and ... pathway in T cells to delineate the regulatory effects of TGFβ on T cells in the maintenance of joint homeostasis in CIA [11] The transgenic mice express a dominant negative TGFβ type II receptor ... under the control of the human CD2 promoter in T cells This receptor lacks the intracellular kinase domain that is responsible for the phosphorylation of the type I receptor and the subsequent activation...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Development of proteoglycan-induced arthritis depends on T cell-supported autoantibody production, but does not involve significant influx of T cells into the joints." potx
... the presence of T cells within the SCID joints at any stage of arthritis transfer We could detect a small population of T cells (nearly all CD4+ ) in the synovial fluid of the arthritic joints ... other arthropathies [44], the presence of Tregs in the joints of naïve animals after passive transfer of arthritis argues for a secondary recruitment of these T cells to the site of inflammation ... software FTY720 treatment For treatment studies, cells were combined after isolation from the spleens and JDLNs of arthritic donors but were not subjected to any separation or labeling These cells...
Ngày tải lên: 12/08/2014, 12:20
Báo cáo y học: " The role of γδ T cells in airway epithelial injury and bronchial responsiveness after chlorine gas exposure in mice" pps
... in the airways of knockout animals, so that it is difficult to conclude that protein induced changes in airway stability and closure contributed to AHR in the current study We speculate that the ... secondary to neutrophil activation could contribute to the extent of shedding [15] The latter mechanism seems less likely since the inflammatory response to epithelial damage was also attenuated ... standard L re-breathing bag to make a concentration of 400 ppm Cl2 The intake port of an exposure chamber was connected to the rebreathing bag while the outlet port was connected to a flow meter...
Ngày tải lên: 12/08/2014, 15:20
Báo cáo y học: "Role of γδ T cells in protecting normal airway function" docx
... eliminated αβ T cells and all αβ T- celldependent responses as potential targets of γδ T cell regulation in this system Nevertheless, the regulatory effect of γδ T cells was evident only after airway ... Born et al expected with unprimed αβ T cells In the latter case, they probably interact with other cells typically commuting between the two tissues, in particular dendritic cells However, it is ... influence of γδ T cells, would result in unnecessary smooth muscle contraction Thus, all of the currently available evidence leads us to propose that γδ T cells are important in the protection of normal...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx
... 5¢-CACCCAAGCTT GCCACCATGGAGGTTCAGCTGCAGCAGTCTG-3¢; primer 7, 5¢-GGT GGAGGAGGTTCTGATGTTTTGATGACCCAAACTCCAC-3¢; primer 8, 5¢-CGAATGCGGCCGCCCGTTTGATTTCCAGCTTGGTGC-3¢; primer 9, 5¢-GGTGGAGGAGGTTCTGATGTTGTTCTGACCCAAACTCCACTC-3¢; ... CCTCCTCACCGGATCCTCCACCTCCAGAACCACCACCCCC-3¢; primer 13, 5¢-CGTCTCCTCAGGGGGTGGTGGTTCTGGAGGTGGAG GATCCGGTGGAGGAGGTTCT-3¢; primer 14, 5¢-CGTCTCCTCA GGGGGTGGTGGTTCTGGAGGTGGAGGATCCGGTGGAGGAGG TTCT-3¢ In all ... and noncoding linker containing an EcoRI site at the 5¢ end of the linker (5¢-AATTCTACAGG TCCTCCTCGCTGATCAGCTTCTGCTCCGAACCTGC-3¢) were annealed and inserted into the NotI ⁄ EcoRI site of all...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo y học: "Increased interleukin-23 receptor+ T cells in peripheral blood mononuclear cells of patients with systemic lupus erythematosu" doc
... than those of the control subjects Because IL-23R can be expressed in both effector and memory cells, it will be of interest to test whether subsets of cells we detected in this study have effector ... patients contained higher percentages of IL-23R+ T lymphocytes as compared to those of the control subjects Expression of IL-23R is reported to be restricted to effector and memory T lymphocytes ... Patients PASI Score Treatments 20.5 No treatment Doses (mg/d) - 15.2 Methotrexate 2.14 11.2 16.2 No treatment Methotrexate 10.71 27 Photo NB-UVB - Mann-Whitney U-test Spearman’s rank correlation...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: "Isolated receptor binding domains of HTLV-1 and HTLV-2 envelopes bind Glut-1 on activated CD4+ and CD8+ T cells" pot
... CD8 T lymphocytes These data are in complete contradiction with the longstanding notions that; 1) quiescent T cells demonstrate very low glucose transport and 2) the energy demands of an activated ... transfected with either Glut-1 or Glut3 Glut-3 is the closest isoform of Glut-1 and has similar glucose transport kinetics [13,14] Flow cytometry analyses of Glut-1-transfected 29 3T cells stained with ... protein is recognized by mAb1418 on quiescent CD8 T cells, these results indicate that the cognate antigen of mAb1418 is not a member of the glucose transporter family http://www.retrovirology.com/content/4/1/31...
Ngày tải lên: 13/08/2014, 09:21
Tài liệu Báo cáo khoa học: EGF receptor in relation to tumor development: molecular basis of responsiveness of cancer cells to EGFR-targeting tyrosine kinase inhibitors docx
... potently against gefitinib, and the level of protection correlates with the extent of Bim reduction, indicating that Bim is essential for gefitinib-induced apoptosis of NSCLC cells The induction ... apoptosis through activation of the caspase-8 ⁄ caspase-3 cascade Treatment of A549 cells with gefitinib results in the translocation of p53 from the cytosol to the nucleus Moreover, inhibition of ... Fas as target molecules of gefitinib p38 As described above, the treatment of intestinal epithelial cells with gefitinib results in a dramatic increase in apoptosis and activation of the intrinsic...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot
... protein with the signaling receptor subunits gp130 and LIF-R (A) Immunodetection of HyperCNTF protein in the supernatants of transiently transfected COS-7 cells The C-terminal CNTF moiety of the ... above We conclude that the HyperCNTF-induced neurite outgrowth is most likely mediated by activation of the MAPK pathway and that this response is substantially independent of the JAK/STAT pathway ... different cells Alternatively, the duration of activation of the distinct signal transduction pathways might be differentially regulated [50] Interestingly, we have observed that HepG2 cells stimulated...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo Y học: Role of three isoforms of phospholipase A2 in capacitative calcium influx in human T-cells pot
... phosphorylated after anti-CD3 stimulation in human T- lymphocytes Addition of TG potentiates the induction of mRNA of these four PLA2 isotypes The mechanism of action of TG on the induction of these enzymes ... as compared to BEL Whether TG exerts its action at the transcriptional level, we detected the expression of mRNA, encoding for these four PLA2 isotypes We observed that, in RT-PCR, Jurkat T- cells ... constitutively express the mRNA of four PLA2 isotypes (type IB, type V, type IV and type VI) Interestingly, addition of TG stimulated the induction of the four PLA2 isotypes in Jurkat T- cells...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx
... line that was stably transfected with the NFATZH reporter construct (Oum, J.-H & Park, J., unpublished results) The reporter construct contained three copies of the distal NFAT binding site in the ... independent measurements supporting our contention that RA modulates the transactivation function of NFAT We also cotransfected the NFAT(FasL)-Luc reporter, along with the retinoid receptor expression ... translation initiation site, and transcription starts from nucleotide )181 [22] (B) Each reporter construct was transiently transfected into Jurkat cells Transfected cells were stimulated with PMA (25...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo khoa học: Tec family kinases: Itk signaling and the development of NKT ab and cd T cells potx
... as alternative modes of development The data that are accumulating suggest that the role of Itk in the development and function of iNKT cells and cd T cells seems to be quite different from conventional ... demonstrating that TCR signal strength is weakened in these T cells [29] These data suggest that Itk regulates the development of Vc1.1 ⁄ Vd6.3 cd T cells through altered TCR signaling strength ... restrains Given that both cell types can secrete IL-4, it is likely that the production of this cytokine, and the T- cell types that can produce it, need to be tightly controlled Like iNKT cells, ...
Ngày tải lên: 28/03/2014, 22:21
báo cáo hóa học:" In vitro generation of cytotoxic and regulatory T cells by fusions of human dendritic cells and hepatocellular carcinoma cells" docx
... soluble factors in the supernatant inhibit the maturation of fusion cells and have a negative impact in the stimulation of T cells To determine the induction of WT1-specitic CD8+ T cells, a pentameric ... http://www.translational-medicine.com/content/6/1/51 Figure The ability of vaccination with autologous FCs to stimulate T cells The ability of vaccination with autologous FCs to stimulate T cells A, Nonadherent PBMCs obtained ... reactivity of CD8+ T cells to WT1 or CEA or both are shown as the percentage of the total population of CD8+ T cells that were double positive (CD8+pentamer+) Cytotoxicity assays The cytotoxicity assays...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf
... of antibodies, at a concentration of 25 μg/mL, were pre-incubated with the target cells for 30 minutes before addition of the stimulated T- cells K562 cells were used as targets to observe natural ... http://www.translational-medicine.com/content/6/1/56 Competing interests The authors declare that they have no competing interests Authors' contributions YY performed protein and AAV generation and all PCR experiments and drafted ... restricted In this experiment, different doses of AAV/IE1 vector were used for DC loading and a zero virus control (PBMC only) The cytotoxicity of the stimulated T- cells directly correlated with the...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot
... concluded that hTERT p540 is not expressed or is cryptic on the surface of tumour cells and that immunization of cancer patients with hTERT p540 leads to the production of T cells that not recognize tumour ... tumour cells in vivo based on this epitope [67-69] In contrast to these studies, the ability of our vaccination strategy to generate tetramer+ CD8 +T cells specific to p540 of hTERT highlights its ... pathological data for all patients who underwent vaccination with hTERT-pulsed DCs homing of the tumour-specific T cell populations to tumour sites contributes to the effectiveness of the antitumour...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Identification of a public CDR3 motif and a biased utilization of T-cell receptor V beta and J beta chains in HLA-A2/Melan-A-specific T-cell clonotypes of melanoma patients" potx
... GCCAGCAGTTT TCT 40 GCCAGCAGTTTA B/22 GCCAGCAGT C A .ACAGGG TTTGGG 41 GCCAGCAG CCA .ACAGGGG CTCGG B/9 GCCAGCAGTTT TCA GGGAC TCGG aNucleotides 5' J region C GGG TTGGG CAGCCCCAGCA T .TATGGCTACACC ... put into the characterization also of tumor Ag-specific TRs Several data demonstrated a major role of TRAV than TRBV chains in TR-Ag recognition, due to the higher number of contacts of this chain ... efficient antimelanoma vaccines Competing interests The authors declare that they have no competing interests Authors' contributions FS, and AS have made substantial contribution in the acquisition...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx
... capacity, C the concentration of the 3a-G1-Julo, Kd is the dissociation constant and k the coefficient of the non-specific fixation component Interestingly, competition experiments revealed that the ... cytotoxic against the K562 cell line and that 3a-G1 doesn 't affect their cytotoxicity when compared with untreated cells [see Additional file 1] Contrary to expectation, we could not demonstrate ... dilution of purified CD4+ T cells stimulated with anti-CD3/CD28 coated beads c) Regulatory activity of 3a-G1 is restricted to T cells as under the same conditions IL-2 stimulated proliferation of...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Prognostic impact of ZAP-70 expression in chronic lymphocytic leukemia: mean fluorescence intensity T/B ratio versus percentage of positive cells" pot
... was evaluated with the T- method utilizing the standard cutoff of 20% positive cells, as well as with the T/ B Ratiomethod; in the latter case, the cut-off of 3.0 identified in the test set was chosen ... estimate the optimal cut-off capable to split patients into groups with different time to treatment (TTT) probabilities applied to ZAP-70 expression values determined according to T/ B Ratio-method ... For the ISO-method marker was set to have
Ngày tải lên: 18/06/2014, 16:20