clinical manifestations of human vitamin and mineral disorders a resumé
báo cáo sinh học:" The double burden of human resource and HIV crises: a case study of Malawi" docx
... Government of Malawi, Ministry of Health and Population: Malawi National Health Accounts: a broader perspective of the Malawian Health Sector 2001 Government of Malawi, Ministry of Health and Population: ... Malawi, Ministry of Health and Population: Malawi National Health Accounts: a broader perspective of the Malawian Health Sector, 2001) In theory, health care providers in Malawi are organized according ... notable features of the health workforce in Malawi are the extensive use of clinical officers, medical assistants and about 4500 community-based health surveillance assistants (HSAs) Clinical officers...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo y học: " Local epidemiology and clinical manifestations of Lyme disease"
Ngày tải lên: 03/11/2012, 11:11
Báo cáo y học: "Associations between the HLA-A polymorphism and the clinical manifestations of Behcet’s disease" pps
... effect of HLA -A* 02:07 and A* 26:01 and their genetic interaction with HLA-B*51 on these clinical manifestations (Table 5) There was a trend that HLA-B*51 and HLA -A* 02:07 are additive to All subjects ... Nippon Ganka Gakkai Zasshi 2008, 112:451-458 Verity DH, Wallace GR, Vaughan RW, Kondeatis E, Madanat W, Zureikat H, Fayyad F, Marr JE, Kanawati CA, Stanford MR: HLA and tumour necrosis Page of 28 ... HLA -A gene in Korean BD patients and investigated the associations between its alleles and BD and the clinical features of BD Page of phycoerythrin-conjugated streptavidin and immediately examined...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: "Prevalence and clinical manifestations of gastro-oesophageal reflux-associated chronic cough in the Japanese population" pdf
... frequency of this association has not been clarified [2] In a study of extraoesophageal manifestations in GOR, laryngeal manifestations are observed in 10.4% of patients with GOR and are significantly ... without laryngeal symptoms was alleviated and ceased within a few days after initiation of PPI However, in of patients who had Table 1: Patients' characteristics Age (years) Gender (male/female) ... heartburn, and presented laryngitis and frequent alkaline regurgitation, the cough had ceased spontaneously as well as heartburn and laryngitis Although there are no diagnostic criteria for alkaline...
Ngày tải lên: 13/08/2014, 08:20
Báo cáo y học: " Wesleyan University, Middletown, CT 06459, USA. #Divisions of Human Biology and Clinical" docx
... Summary statistics and query interfaces for the PeptideAtlas are available at [31] Perl cgi-bin programs and Java servlets and JSP pages enable public queries of the database and public archive area ... PeptideAtlas database with minimum sample annotation.) The PeptideProphet software is available at our Sashimi software site [23] The SBEAMS database application and the Proteomics module and PeptideAtlas ... isotope-coded affinity tag (ICAT) and tandem mass spectrometry: I Statistically annotated datasets for peptide sequences and proteins identified via the application of ICAT and tandem mass spectrometry...
Ngày tải lên: 14/08/2014, 17:22
Tài liệu Molecular Neurobiology of Alzheimer Disease and Related Disorders doc
... Takashi Kudo, Toshihisa Tanaka, Katsuhiko Yanagisawa, Akihiko Takashima, Takeshi Ishihara, Takeshi Tabira, Akihiko Nunomura, Tetsuaki Arai (Third row) Yoshitaka Tatebayashi, Taiichi Katayama, ... GACCAUCUUCUUGGUGGU GCUCUACAAG - - - - GCUGCUACAAG GCUCUAAAAGUACCGCUGCUAAAAG H 10 11 UGGUGGUGCUCUACAAGUA GCUCUACAAGUACCGCUGCUACAAG CCGCUGCUACAAG gugaggcccu Exon Intron d Fig UV cross-linking assays of PS2 exon ... induced aberrant splicing of a particular gene in Katayama/Manabe/Imaizumi/Sato/Hitomi/Kudo/Yanagita/Matsuzaki/ Mayeda/Tohyama 28 the absence of any mutations We demonstrated that HMGA 1a is a key factor...
Ngày tải lên: 14/02/2014, 17:20
Mobility of Human Resources and Systems of Innovation pdf
... Maimbo and Ratha (2005) and Freund and Spatafora (2005) for surveys of international remittances 64 The importance of remittances in alleviating poverty and inequality is discussed in Adams and ... Mozambique, Namibia, South Africa, Swaziland, United Republic of Tanzania, Zambia and Zimbabwe The Johannesburg–Tshwane urban agglomeration consists of more than three separate municipal authorities, ... Social capital measures; • Intellectual property rights statistics; • National and international immigration and emigration data; • National register data; • Case studies of S&T institutions and...
Ngày tải lên: 06/03/2014, 05:22
Báo cáo khoa học: Respective roles of the catalytic domains and C-terminal tail peptides in the oligomerization and secretory trafficking of human acetylcholinesterase and butyrylcholinesterase potx
... case letters (a and b), so that the wild-type AChE and BChE are Aa and Bb, and the chimeras are Ab and Ba Comparisons of wild-type enzymes and chimeras, as well as of various mutants, show that ... capital letters (A and B) and the C-terminal peptides by lower case letters (a and b), so that the wild-type enzymes are abbreviated as Aa and Bb The C-terminal t peptides of human AChET (a) and ... are a few differences between man and Maccaca mulatta, and the K variant of human BChE, which occurs with high frequency in European and American populations, consists of the replacement of A6 ...
Ngày tải lên: 07/03/2014, 03:20
Mechanical behaviour of human epidermal and dermal layers in vivo pdf
... lateral and vertical stretching in histology (Rajadhyaksha et al., 1999b) Confocal images of the granular, spinous and basal cell layers correlated well with histology (Rajadhyaksha et al., 1999b) ... depth of the focal plane and combining the obtained images computationally, leads to a 3D image (Sheppard and Shotton, 1997; Rajadhyaksha and Zavislan, 1997) photomultiplier confocal aperture point ... the stratum granulosum the degradation of mitochondria and nuclei starts and the cytoplasm of the flattened cells becomes almost filled by keratohyalin masses and filaments Also the cell membranes...
Ngày tải lên: 09/03/2014, 00:20
BIOLOGICAL ASPECTS OF HUMAN HEALTH AND WELL-BEING ppt
... biotechnological applications of cyanobacteria CYANOBACTERIA ARE SOURCE OF A LARGE VARIETY OF BIOCOMPOUNDS Cyanobacteria can also perform syntheses that are of biotechnological significance Like many genera ... industrial scales Use of Spirulina as a source of protein and vitamins for humans or animals has been reviewed by Ciferri [1983] and Kay [1991] Spirulina platensis and Spirulina maxima are thought ... As to the sialyltransferases, all of the sialyltransferases have been classified into five families in the CAZy (carbohydrate-active enzymes) database (family29, 38, 42, 52 and 80), and all of...
Ngày tải lên: 14/03/2014, 21:20
Textbook of Sports Medicine Basic Science and Clinical Aspects of Sports Injury and Physical Activity pot
... each lower limb to approximately landings and takeoffs Clearly, a certain degree of appropriate tissue adaptation has already taken place to withstand these vastly different loads, but nevertheless, ... longitudinal studies involving pharmacologic autonomic blockade and analysis of HRV indicate that increases in cardiac parasympathetic (vagal) tone make an important contribution to resting bradycardia ... lation between V2 and ventilation (VE) At a given power or ATP turnover, V2 is quantitatively related to the balance between fat and carbohydrate as fuels, and the amount of lactate accumulating...
Ngày tải lên: 15/03/2014, 09:20
HYGIENIC PHYSIOLOGY WITH SPECIAL REFERENCE TO THE USE OF ALCOHOLIC DRINKS AND NARCOTICS BEING A REVISED EDITION OF THE FOURTEEN WEEKS IN HUMAN PHYSIOLOGY ppt
... diseases, accidents, etc., and, when practicable, their mode of treatment A pupil may thus learn, for example, the cause and cure of "a cold," the management of a wound, or the nature of an inflammation ... respiration, circulation, and the nervous system Leidy's "Human Anatomy," and Sappey's "Traité d'Anatomie" have been followed on all anatomical questions, and have furnished many beautiful drawings Huxley's ... Bain's "Mind and Body"; Pettigrew's "Animal Locomotion"; Carpenter's "Human Physiology," and "Mental Physiology"; Wilder and Gage's "Anatomy"; Jarvis's "Physiology and Laws of Health." Hargreaves's...
Ngày tải lên: 15/03/2014, 13:20
Mobility of Human Resources and Systems of Innovation pptx
... Maimbo and Ratha (2005) and Freund and Spatafora (2005) for surveys of international remittances 64 The importance of remittances in alleviating poverty and inequality is discussed in Adams and ... Mozambique, Namibia, South Africa, Swaziland, United Republic of Tanzania, Zambia and Zimbabwe The Johannesburg–Tshwane urban agglomeration consists of more than three separate municipal authorities, ... Social capital measures; • Intellectual property rights statistics; • National and international immigration and emigration data; • National register data; • Case studies of S&T institutions and...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo khoa học: Differential binding of human immunoagents and Herceptin to the ErbB2 receptor ppt
... described above were calculated by non-linear analysis of the association and dissociation curves using SPR kinetic evaluation software (package BIAevaluation 3.2, Biacore AB), fitting data to the : Langmuir ... San Francisco, CA, USA); horseradish peroxidase-conjugated anti-His IgG1 (Qiagen, Valencia, CA, USA); horseradish peroxidase-conjugated goat anti -human affinity-isolated IgG1 (Fc-specific; Sigma, ... show the Scatchard analysis of the binding data The calculated constants from these plots (KD1 and KD2) are listed in Table Table Affinity and rate constants for ErbB2-ECD ⁄ ligand interactions determined...
Ngày tải lên: 23/03/2014, 06:20
Clinical manifestations of pulmonary tuberculosis pot
... the addition of rifampin (RIF) or pyrazinamide (PZA) to a base regimen of daily INH and SM, that ethambutol (EMB) was roughly as effective as SM (allowing all-oral therapy), and that PZA and ... interval The Occupational Safety and Health Administration (OSHA) applies the general respiratory protection standard which requires annual fit testing and medical evaluations However, this standard ... isoniazid, rifampin, pyrazinamide, and ethambutol (table 1) Drug doses are shown in the Tables (table and table and table and table 5) Sputum AFB smears and cultures should be obtained at the...
Ngày tải lên: 29/03/2014, 03:20
The Clinical Practice of Complementary, Alternative, and Western Medicine pot
... CAM offers the physician a financial shot in the arm with a cash practice — a fair payment for a fair service At this time more and more insurers and HMOs are embracing CAM as part of their offered ... intellectual, financial, and emotional safety of pathology and opened up a general medical practice — my very own laboratory The medical modalities of treatment I learned and practiced were chosen based ... nutrition, and neural therapy are all regarded as “the practice of medicine.”15 The issue of “customary and usual treatment” as a discriminatory tool against CAM will fall by the wayside as CAM becomes...
Ngày tải lên: 29/03/2014, 07:21
diaz - color atlas of human poisoning and envenoming (crc, 2006)
... intravascular (intravenous, intra-arterial), intramuscular Cutaneous: Topical and transdermal Miscellaneous: Inhalation, sublingual, transmucosal, intranasal, intrathecal, intraventricular Rates of Absorption ... biological warfare and agricultural and antipersonnel terrorism Many biological toxins, such as poison hemlock, pyrethrin, and red squill, and man-made toxoids, such as arsenic and thallium salts and ... War I and in very recent wars (Iran-Iraq War) and terror attacks (Sarin nerve gas attacks in Japan) This book will serve as a visual and written reminder of the ubiquitous sources of toxins and...
Ngày tải lên: 03/04/2014, 12:04
schaum's outline of human anatomy and physiology - kent m. van de graaff, r. ward rhees
... đằơã-áã ằ ắẳĐ ơáằđ đằ ẳằ ã đằằđằẵằ -ơẳđẳ ơãẵ -ãơãũ ì ơãẵ -ãơãụ ơáằ ắẳĐ ã- ằđằẵơụ ằằơ đằ đằ ẳ A ơáằ A ụ ằĐằ- đằ ẳãđằẵơằẳ đâđẳụ ẳ đ- đằ ơáằ -ãẳằ- ơáằ ắẳĐ âãơá ơáằ - ơáằ áẳ- ơôđằẳ đâđẳ ẳ ơáằ Bạằđ- ... ắôằđ -Đ-ú ơằ- ôẳ ã ơáằ ắẳĐ đằ ơáằ ắãẵđắơằ ắôằđ ôẳ ã ơáằ ắẳ ẳ ơáằ ằăơđẵằôđ A ãẳụ ơáằ á-áơằ ắôằđ ã ơáằ àãẳằĐ- ẳ ơáằ ãơđẵằôđ A ãẳụ ẳ ơáằ đơằã ắôằđ ôẳ ã ơã ôằ-ũ ìđạãẵ ẵôẳ- ẳ ẵơã ẵđắ ứằăẵằơã- ãẵôẳằ ... ứẳằ-ẵđãắằẳ ắêằữũ èáằĐ đằ ẵ-ằẳ ơáã -áằằơ- ằãơáằã ơã ôằ ơáơ ôắđãẵơằụ -ôđơụ ẳ ẵđơằú ơãƯằ êã-ẵằđ đạ-ũ ằđô- A ãẳ ã- ơáằ âơằđĐ ôắđãẵơ ơáằĐ -ằẵđằơằũ èáằ -ằđô- ằắđằ- ơáằ ơáđẵãẵ ẵêãơĐ đằ ơáằ đãằơ ẳ êã-ú ẵằđ...
Ngày tải lên: 08/04/2014, 12:37
schaum's outline of human anatomy and physiology - kent m. van de graaff, r. ward rhees
... đằơã-áã ằ ắẳĐ ơáằđ đằ ẳằ ã đằằđằẵằ -ơẳđẳ ơãẵ -ãơãũ ì ơãẵ -ãơãụ ơáằ ắẳĐ ã- ằđằẵơụ ằằơ đằ đằ ẳ A ơáằ A ụ ằĐằ- đằ ẳãđằẵơằẳ đâđẳụ ẳ đ- đằ ơáằ -ãẳằ- ơáằ ắẳĐ âãơá ơáằ - ơáằ áẳ- ơôđằẳ đâđẳ ẳ ơáằ Bạằđ- ... ắôằđ -Đ-ú ơằ- ôẳ ã ơáằ ắẳĐ đằ ơáằ ắãẵđắơằ ắôằđ ôẳ ã ơáằ ắẳ ẳ ơáằ ằăơđẵằôđ A ãẳụ ơáằ á-áơằ ắôằđ ã ơáằ àãẳằĐ- ẳ ơáằ ãơđẵằôđ A ãẳụ ẳ ơáằ đơằã ắôằđ ôẳ ã ơã ôằ-ũ ìđạãẵ ẵôẳ- ẳ ẵơã ẵđắ ứằăẵằơã- ãẵôẳằ ... ứẳằ-ẵđãắằẳ ắêằữũ èáằĐ đằ ẵ-ằẳ ơáã -áằằơ- ằãơáằã ơã ôằ ơáơ ôắđãẵơằụ -ôđơụ ẳ ẵđơằú ơãƯằ êã-ẵằđ đạ-ũ ằđô- A ãẳ ã- ơáằ âơằđĐ ôắđãẵơ ơáằĐ -ằẵđằơằũ èáằ -ằđô- ằắđằ- ơáằ ơáđẵãẵ ẵêãơĐ đằ ơáằ đãằơ ẳ êã-ú ẵằđ...
Ngày tải lên: 08/04/2014, 12:40
the johns hopkins university press the medicalization of society on the transformation of human conditions into treatable disorders apr 2007
... Press) and Journal of Health and Social Behavior; chapters and appeared in a slightly different form in Social Problems and Sociology of Health and Illness; chapter appeared in a much shorter and ... disease awareness campaigns to raise the public visibility of SAD and GAD The pharmaceutical company’s savvy approach to publicizing SAD and GAD, which relied upon a mixture of “expert” and patient ... claims that Riessman and others have made about women and medicalization, I would like to make a case for the increasing medicalization of men and to broaden the understanding of medicalization...
Ngày tải lên: 11/06/2014, 12:48