... Buckley and Steven Freeland 17 Other Debt-for-Development Exchanges Ross P Buckley 41 Part II╅Exchanges by Donor Countries United States Debt Exchanges Ross P Buckley and Steven Freeland 51 ... Protection:€A Potential Form of Debt-for-Development Exchange John Langmore 185 199 209 Contents ix 18 Climate Change Adaptation Exchanges:€An Exploration of the Possibilities and Risks Philip Ireland ... exchanges and, finally, the security threats posed by environmental degradation and climate change The penultimate chapter in the volume is by Emmanuel T Laryea and explores how information and...
Ngày tải lên: 03/11/2014, 18:36
... storage The Scandinavian School of Brewing Den Skandinaviske Bryggerhøjskole Tank Farm the brewery The Scandinavian School of Brewing Den Skandinaviske Bryggerhøjskole Beer Filter The Scandinavian ... Pasteuriser The Scandinavian School of Brewing Den Skandinaviske Bryggerhøjskole Volumetric Filler The Scandinavian School of Brewing Den Skandinaviske Bryggerhøjskole Labelling machine The Scandinavian ... filtered in candle filters The Scandinavian School of Brewing Den Skandinaviske Bryggerhøjskole Beer process flow diagram The Scandinavian School of Brewing Den Skandinaviske Bryggerhøjskole Fermentation...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo khoa học nông nghiệp " Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam " docx
... millers and extension workers aware of various factors responsible for harvesting and milling losses and degradation of rice quality To increase the research and teaching capability of institution and ... OM 2718 and OM 1490, An Giang 24 and Jasmine were chosen in Can Tho, Kien Giang and An Giang provinces, respectively Using a randomised block design, the rice was harvested days prior and days ... time and methods on cracking fraction of rice and losses for different varieties and seasons The objective of this experiment is to determine the effect of harvesting time on kernel cracking and...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report: " Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam - Ms5" pot
... Vietnamese and Australian coordinators in Thailand and Philippines to learn about their experiences in rice cracking and get aware of their current activities in relation to postharvest handling ... millers and extension workers aware of various factors responsible for harvesting and milling losses and degradation of rice quality To increase the research and teaching capability of institution and ... and subsequent grain handling techniques are observed to improve rice grain quality Similarly there will be demonstration and workshops for small millers to encourage them to install driers and/ or...
Ngày tải lên: 21/06/2014, 06:20
INVESTIGATION OF RICE KERNEL CRACKING AND ITS CONTROL IN THE FIELD AND DURING POST-HARVEST PROCESSES IN THE MEKONG DELTA OF VIETNAM " ppt
... Khanh, and Mr Nguyen Thanh Nghi 9:35 – 9:40: Tour preparation 9:40 – 10:00: Transportation to Tan Phat A co-operative to visit dryer and combineharvester 10:00 – 11:00: Demonstration the dryer and ... Khanh, and Mr Nguyen Thanh Nghi 9:35 – 9:40: Tour preparation 9:40 – 10:00: Transportation to Tan Phat A co-operative to visit dryer and combineharvester 10:00 – 11:00: Demonstration the dryer and ... in July-2007 At Kien Giang Province Project: INVESTIGATION OF RICE KERNEL CRACKING AND ITS CONTROL IN THE FIELD AND DURING POST-HARVEST PROCESSES IN THE MEKONG DELTA OF VIETNAM Figure 1: Opening...
Ngày tải lên: 21/06/2014, 06:20
Nghiên cứu khoa học nông nghiệp " INVESTIGATION OF RICE KERNEL CRACKING AND ITS CONTROL IN THE FIELD AND DURING POST-HARVEST PROCESSES IN THE MEKONG DELTA OF VIETNAM " pptx
... Lam, and Mr Nguyen Thanh Nghi 9:35 – 9:40: Tour preparation 9:40 – 10:00: Transportation to Tan Thoi co-operative to visit dryer and combineharvester 10:00 – 11:00: Demonstration the dryer and ... Lam, and Dr Phan Hieu Hien 9:35 – 9:40: Tour preparation 9:40 – 10:00: Transportation to Tan Thoi co-operative to visit dryer and combine-harvester 10:00 – 11:00: Demonstration the dryer and harvester ... (Vinh Thanh & Thot Not Districts) Project: INVESTIGATION OF RICE KERNEL CRACKING AND ITS CONTROL IN THE FIELD AND DURING POST-HARVEST PROCESSES IN THE MEKONG DELTA OF VIETNAM Figure 1: Opening...
Ngày tải lên: 21/06/2014, 06:20
Project Completion Report:" Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam - MS4 " docx
... harvesting losses Harvesting method Hand Reaper Combined harvester Hand and heaped immediately Hand and dried in the sun (one day) Reaper and heaped immediately Reaper and dried in the sun (one day) ... wind, rats, and handling Lodging loss: plants with mature grains fall on the ground making the grains difficult to recover Standing crop loss: standing plants with mature grains are left standing ... harvester and dryers Provincial government for the farmers Integrated data on harvest and post-harvest losses of rice and information on the use of harvesters and dryers From the experiments and surveys...
Ngày tải lên: 21/06/2014, 06:20
Project Completion Report: Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam - APPENDIX 1 " pdf
... fluidized drying (80 and 90 oC for 2.5 and 3.0 min), and tempering for up to h, on hardness and stiffness of A10 and OM2717 rice varieties The single bar plot at the right hand of each figure is ... yield and colour of milled rice Tables and list the percentage of fissured kernels, head rice yield, and discolouration in terms of total colour difference (∆E*) and yellowness (b*) of A10 and ... higher head rice yield and maintains whiteness, while giving a high drying capacity and reduced energy consumption [10] There have been many research reports on the potential and use of high temperature...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report: Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam - APPENDIX 3A" pptx
... head rice recovery and total rice recovery should be around 59% and 69%, respectively (as rice is comprised of around 10% bran and 20% husk) In literatures, the head rice recovery and total rice ... presented in Tables and The real data and data collected by survey were quite coherent Both data suggested that the head rice recovery in small scale mills was the lowest and was as low as 33% ... results obtained in this survey were illustrated in leaflets and conveyed to the farmers, millers and mill operators through training and workshops 123 Ministry of Agriculture & Rural Development...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report: ReInvestigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam - MS4 " docx
... method Notation Hand and heaped immediately Hand and dried in the sun (one day) Reaper and heaped immediately Reaper and dried in the sun (one day) Hand and heaped immediately Hand and dried on the ... co-operative, CanTho (OM 2718, OM1459) Harvesting method Hand and heaped immediately Hand and dried in the sun (one day) Reaper and heaped immediately Reaper and dried in the sun (one day) Average Notation ... mechanical harvesting reduced harvesting losses 13 Table 12: Effect of harvesting methods on the harvesting losses Harvesting method Hand Reaper Hand and heaped immediately Hand and dried in the sun...
Ngày tải lên: 21/06/2014, 06:20
Card Project Progress Report: Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam " MS7 ppt
... July/07, 22-23Sep/07 and 29-30Sep/07, such as the pictures of the farmers in the training lesson hall and in the demonstration places The subscripts V and E are for Vietnamese and English, respectively ... milestone requirements: • Training manuals for extension workers and farmers in English and Vietnamese • Extension pamphlets and posters Please note that not all the contents have been translated ... English Only the essential information of training manuals and contents are presented in English This is due to the limit of resources and time and actual usefulness of translation of full documents...
Ngày tải lên: 21/06/2014, 06:20
Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam - MS6 " pptx
... Australia: Team Leader Name: Bhesh Bhandari Position: Associate Professor Organisation: The University of Queensland Telephone: +61733469192 Fax:+61733651177 Email:b.bhandari@uq.edu.au In Australia: ... Leader Dr Vinh Truong Australian Organisation The University of Queensland Australian Personnel Associate Professor Bhesh Bhandari Professor Shu Fukai Date commenced April 2006 Completion date ... 1 Institute Information Project Name Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam Vietnamese Institution...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report: " Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam - MS8 & MS9 " pot
... harvesting and drying practices, and demonstrations of dryers and combine harvesters were held for local extension officers and farmers through training sessions in 10 districts in Can Tho and Kien ... 40, 60, and 80oC and then tempered for 0, 40, 80 and 120 Dried rice samples were then stored up to four months at 4, 20 and 38 oC The investigation of post-drying annealing effect at above and below ... of changes in physico-chemical properties of rice due to high temperature compact-drying system Investigation of changes in milling quality and physical strength due to postdrying annealing and...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report:" Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam - MS12 " pot
... harvester and dryers Provincial government for the farmers Integrated data on harvest and post-harvest losses of rice and information on the use of harvesters and dryers From the experiments and surveys ... and subsequent grain handling techniques are observed to improve rice grain quality Similarly there will be demonstration and workshops for small millers to encourage them to install driers and/ or ... during harvest and post-harvest periods and to find out the optimal harvesting time, harvesting methods, drying conditions and milling performance The systematically data collection and experimental...
Ngày tải lên: 21/06/2014, 06:20
Báo cáo nghiên cứu khoa học " CONTROLLING RICE KERNEL CRACKING IN THE FIELD AND POST-HARVEST PROCESSES IN THE MEKONG DELTA " pptx
... system data and carry out milling experiments for medium and large capacities of ton/hour and ton/hour, respectively To investigate changes in physicochemical properties, milling quality and physical ... Amaroo and Reiziq (medium-grain) Paddy samples were dried at 40, 60, and 80oC and then tempered for 0, 40, 80 and 120 The dried rice samples were then stored up to four months at 4, 20 and 38 ... harvesting and milling losses and degradation of rice quality To increase the research and teaching capabilities of institution and staff members on rice quality and related products To build...
Ngày tải lên: 22/06/2014, 12:20
VideoStudio Pro X3 kicks the movie making process into high gear
... Blu-ray and everything in between VideoStudio Pro now includes DVD Factory Pro integrated DVD and Blu-ray authoring and burning Complete HD workflow – import, edit, burn and share standard or ... Facebook and Flickr® Now also in HD! Burn CDs, DVDs, Blu-ray and AVCHD discs New! Burn HD video to standard DVD media to play on a DVD or Blu-ray player Take your movies to go on iPod, iPhone®, PSP and ... * Compatible with: Windows XP/ Vista and (32/64-bits) * Multilingual: English, Spanish, French, Italian, German, Chinese, Janapense, Netherlands, Russian and Polish * Size: 1.15 GB http://www.corel.com/akdlm/6763/down...
Ngày tải lên: 27/08/2012, 11:20
USING THE ANALYTIC HIERARCHY PROCESS APPROACH FOR ASSESSMENT OF THE STRENGTH OF UNIVERSITY-INDUSTRY-GRI COOPERATION IN VIETNAM
... fields) and candidates, 3,000 professors and professor candidates, 45,000 scientists and 20,000 university lecturers Vietnam has 300 research 29 institutes, 105 universities and colleges and 86 ... means for additional research Basic research Outputs Standard and rules Recognition and rewards Knowledge and learning Cost-effective products and services New application Organizational rationality ... scientists, and business people The respondents considered have been taken those who have idea and experience on the issue of University-Industry-GRI cooperation and could understand the factors and...
Ngày tải lên: 23/04/2013, 10:29
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
... #!!(),)## 1.23452/0267/8 '"# Figure Band intensities for Nitrobacter species While in Figure 4, the band intensities were high only in Runs and 7, and their band intensities were quite similar, ... with PCR and FISH By both of PCR and FISH analyses, only Nitrobacter species were detected The PCR result with FGPS primer set is shown in Figure The band intensitis were quantified, and were ... CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r...
Ngày tải lên: 05/09/2013, 09:38
Evaluation of the Innovated Disinfection Process with High Dissolved CO2
... Association) (1989) Standard methods for the Examination of Water and Wastewater, AWWA and WCPC, Washington D.C Dixon N M and Kell D B (1989) The inhibition by CO2 of the growth and metabolism of ... sample, and N was the corresponding viable number of microorganisms after treatment Suspended solid (SS) and volatile suspended solid (VSS) were analyzed by Standard methods for water and wastewater ... Sewage Works Association) (1997) Standard methods for the examination of sewage wastewater (Japanese), Tokyo, Japan, 698-718 Jyoti K K and Pandit A B (2004) Ozone and cavitation for water disinfection...
Ngày tải lên: 05/09/2013, 10:15
This questionnaire is designed to investigate teachers’ attitude towards the applicability of process approach in teaching writi
... and learners’ profile and their methods and strategies in teaching and learning writing skill On the whole, the teaching and writing at non- major class is not as effective and interesting as expected ... three main issues: the comments of teachers and students on the textbook “English 10”, teachers and students’ teaching and learning methods and strategies and teachers’ judgments on the applicability ... varied, effective and relevant 36% and 34% of the students say that the topics are difficult and uninteresting respectively No one thinks that the exercises and topics are not varied and not effective...
Ngày tải lên: 07/09/2013, 13:51