choice of autoshaping as a behavioral assay

A contrastive analysis of encouraging as a speech act in english and vietnamese

A contrastive analysis of encouraging as a speech act in english and vietnamese

... STATEMENT OF THE PROBLEM teachers and learners of English as well as other potential interactants In the past, a series of studies regarding different speech acts of international communication ... emergence of English as an international language in this century, there are a great number of the Vietnamese people who learn and speak English In fact, in learning English as a foreign language, ... describes and analyzes the syntactic and pragmatic features of 2.2.2.2 Classifications of speech acts directives in English and Vietnamese Searle (1975) has set up the following classification of Trương...

Ngày tải lên: 26/11/2013, 13:31

13 1,6K 8
Tài liệu The Man of Letters as a Man of Business docx

Tài liệu The Man of Letters as a Man of Business docx

... that in writing of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as ... knows that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with ... much of a business man after all He must still have a low rank among practical people; and he will be regarded by the great mass of Americans as perhaps a little off, a little funny, a little soft!...

Ngày tải lên: 17/02/2014, 19:20

21 544 0
Tài liệu Test of English as a Foreign Language doc

Tài liệu Test of English as a Foreign Language doc

... 110 Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Azores Bahamas Bahrain Bangladesh Barbados Belarus ... Sch of Intl Service AMIDEAST Catholic U of America Embassy of Botswana Embassy of the Arab Republic of Egypt Embassy of India Embassy of Japan Embassy of Kuwait Embassy of Malaysia Embassy of ... Lithuania Luxembourg Macau Macedonia, former Yugoslav Republic of Madagascar Madeira Islands Malawi Malaysia Maldives Mali Malta Northern Mariana Islands Marshall Islands Martinique Mauritania Mauritius...

Ngày tải lên: 20/02/2014, 11:21

36 870 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

... nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of no return’ in the apoptotic signaling cascade ... between the nucleus and the cytoplasm Whereas cytoplasmic TRADD mediates apoptosis through FADD and caspase-8 activation, nuclear TRADD acts through a mitochondrial apoptosis pathway [28] Our study ... cytoplasm of z-IETD-treated cells (Fig 5A, panels 22–24) Thus, inhibition of caspase-8 activation does not affect the initial nuclear–cytoplasmic translocation of FADD; however, FADD relocalization...

Ngày tải lên: 07/03/2014, 02:20

10 483 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase activities were measured as described [17] DNase I protection assay Rat liver and HeLa ... carried out as described by Luciakova et al [13] MALDITOF analysis was performed in reflector mode using a Voyager-DE STR MALDI-TOF mass spectrometer (Applied Biosystems) Internal calibration was performed...

Ngày tải lên: 07/03/2014, 15:20

8 426 0
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf

Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf

... folded GABARAP [22] The addition of CRT to GABARAP resulted in the disappearance of GABARAP resonances, a clear indication of binding (Fig 3B) Only weak amide signals for a Gln ⁄ Asn side chain and ... response Rmax was fitted as a separate parameter for each binding sensorgram The dissociation constant was obtained as Kd ¼ koff ⁄ kon NMR All NMR spectra were recorded at 25 °C on a Varian (Darmstadt, ... 10)4 s)1 Rmax values decreased, as expected, with increasing baseline A dissociation constant of 64 nm for the GABARAP–CRT interaction was Calreticulin is a high affinity ligand for GABARAP Fig Homology...

Ngày tải lên: 16/03/2014, 05:20

13 560 0
Animal waste utilization   effective use of manure as a soil resource

Animal waste utilization effective use of manure as a soil resource

... valid cases This rate varied between kg/ha (a situation where a small amount of manure only was applied) and 1,524 kg/ha (a situation where a field came out of alfalfa, a very large amount of ... capacity as a standard manufacturing requirement This lack of standardization for manure spreaders has forced on farmers the additional task of acquiring a weight calibration for their spreaders ... neither waste nor asset (Dittrich, 1993) Manure was largely viewed as a farm asset up until the early 1960s At that time the theme of manure as a waste, as something to be disposed of, began to...

Ngày tải lên: 16/03/2014, 11:44

319 5,6K 0
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

... signal The MALDI-TOF spectrum of anaerobic apoFNR consisted of one major signal at 28 408 Da after alkylation equivalent to fivefold alkylated apoFNR, and a minor signal of threefold alkylated FNR ... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... protein was precipitated and washed carefully with methanol–chloroform [31] The protein concentration was determined using the Bradford assay [32] and the radioactivity was measured in a scintillation...

Ngày tải lên: 23/03/2014, 15:20

10 477 0
Test  of English  as a  Foreign Language for Internet-Based Testing: Information and Registration BULLETIN

Test of English as a Foreign Language for Internet-Based Testing: Information and Registration BULLETIN

... NATIVE LANGUAGE CODES AFR AKA ALB AMA ARA ARM ASM AZE BAM BAK BAQ BEL BEM BEN BER BIK BOS BUL BUR CAT CEB NYA CHI CHV Afrikaans Akan Albanian Amharic Arabic Armenian Assamese Azerbaijani Bambara ... BWA BRA BRN BGR BFA BDI KHM CMR CAN CPV CYM CAF TCD CHL CHN Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan ... ORM PAU POL PON POR Latvian Lingala Lithuanian Luba-Lulua Luo Macedonian Madurese Malagasy Malay Malayalam Maltese Marathi Marshallese Mende Minangkabau Mongolian Mossi Nepali Norwegian Oriya Oromo...

Ngày tải lên: 25/03/2014, 10:41

28 765 2
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

... nucleotide-binding activity of tissue transglutaminase and its regulation of transamidation activity Proc Natl Acad Sci USA 99, 2743–2747 Ahvazi B, Boeshans KM, Idler W, Naxa U, Steinert PM & Rastinejad F ... sequences as substrate Proc Natl Acad Sci USA 81, 7017–7020 Porta R, Esposito C, Metafora S, Pucci P, Malorni A & Marino G (1988) Substance P as a transglutaminase substrate: identification of the reaction ... Analysis of transglutaminase protein substrates by functional proteomics Protein Sci 12, 1290–1297 Facchiano AM, Facchiano A & Facchiano F (2003) Active sequences collection (ASC) database: a...

Ngày tải lên: 30/03/2014, 15:20

17 441 0
báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot

báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot

... the final manuscript Additional material Additional file Analysis of covariance of each subscale of SF-36 (n = 227) with respect to SOC adjusted for sex, age group, marital status, educational level ... activities such as occupational therapy and participation in the political, cultural and religious arenas In this way, health care professionals can encourage the residents to engage in activities ... sex, martial status, educational level), the variable length of stay was not statistically significant for any subscale Adjusted R2 was unchanged for mental health and vitality and slightly higher...

Ngày tải lên: 18/06/2014, 19:20

9 845 0
Báo cáo hóa học: " Edge-Functionalization of Pyrene as a Miniature Graphene via Friedel–Crafts Acylation Reaction in Poly(Phosphoric Acid)" pdf

Báo cáo hóa học: " Edge-Functionalization of Pyrene as a Miniature Graphene via Friedel–Crafts Acylation Reaction in Poly(Phosphoric Acid)" pdf

... elemental analysis of samples Sample EF FW Table Elemental analysis of graphite and graphite-g-TMPBA Sample Elemental analysis Elemental analysis C (%) H (%) C (%) O (%) As- received graphite Pyrene ... 700 amu The covalent attachment of TMPBA onto pyrene could be confirmed by matrix-assisted laser desorption ionization time of flight (MALDI-TOF) analysis (Fig 2) A series of peak groups appeared, ... the purpose of having a basic understanding of the starting material, pristine graphite was characterized by elemental analysis (Table 2) When theoretical C H N O contents were calculated, the...

Ngày tải lên: 21/06/2014, 17:20

6 392 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx

Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx

... there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... able to obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11] (cf Remarks 2.1 and 4.3) Proof of Eilenberg’s ... Polish Acad Sci Math 51 (2003), no 2, 147–156 C Petalas and T Vidalis, A fixed point theorem in non-Archimedean vector spaces, Proc Amer Math Soc 118 (1993), no 3, 819–821 S Prieß-Crampe, Der Banachsche...

Ngày tải lên: 23/06/2014, 00:20

6 268 0
The Project Gutenberg EBook of The Man of Letters as a Man of Business, by William Dean Howells potx

The Project Gutenberg EBook of The Man of Letters as a Man of Business, by William Dean Howells potx

... that in writing of the Man of Letters as a Man of Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has been done a great deal already; ... knows that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with ... still have a low rank among practical people; and he will be regarded by the great mass of Americans as perhaps a little off, a little funny, a little soft! Perhaps not; and yet I would rather...

Ngày tải lên: 28/06/2014, 17:21

126 362 0
The Project Gutenberg EBook of The Man of Letters as a Man of Business by William Dean Howells pptx

The Project Gutenberg EBook of The Man of Letters as a Man of Business by William Dean Howells pptx

... that in writing of the Man of Letters as a Man of Business I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has been done a great deal already; ... Scribner's Magazine; "Confessions of a Summer Colonist" was done at York Harbor in the fall of 1898 for the Atlantic Monthly, and was a study of life at that pleasant resort as it was lived-in ... as the first form, is so often a lasting death An interesting proof of the value of the magazine to literature is the fact that a good novel will often have wider acceptance as a book from having...

Ngày tải lên: 28/06/2014, 17:21

130 318 0
the balance of payments as a monetary phenomenon

the balance of payments as a monetary phenomenon

... deal of attention to stable balance of payments situations The main aim of this paper is to examine the monetary approach to the balance of payments (MABP), which argues that the balance of payments ... monetary approach to balance of payments theory Journal of financial and quantitative analysis, 7:1555–1572 Laffer, AB 1969 The US balance of payments – A financial center view Law and contemporary ... Lachman, D 1975 A monetary approach to the South African balance of payments The South African journal of economics, 43(3):271–283 Lanciaux, B 1990 An institutional analysis of the monetary approach...

Ngày tải lên: 13/07/2014, 21:13

12 483 1
Báo cáo khoa học: "Mutation and overexpression of p53 as a prognostic factor in canine mammary tumors" pptx

Báo cáo khoa học: "Mutation and overexpression of p53 as a prognostic factor in canine mammary tumors" pptx

... prognostic value of several parameters All statistical analyses were performed with software package SPSS (Release 8.0, SPSS inc.) and a P-value of

Ngày tải lên: 07/08/2014, 17:22

7 326 0
Báo cáo khoa học: "An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different branching intensities" ppt

Báo cáo khoa học: "An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different branching intensities" ppt

... maintaining an acceptable combination of height and diameter growth An important part of our oak improvement programme aims to gain a better understanding of the development and control of branching ... active was assessed at 8-d intervals — — — At the end of the first period of growth the number of lateral branches on the original shoot was counted before removing all new ... been analysed separately The effects of clones and treatments were investigated by analysis of variance As previous studies have shown that bud and branch numbers are related to shoot length (Harmer,...

Ngày tải lên: 08/08/2014, 19:21

14 240 0
Báo cáo y học: "Screening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lupus erythematosus with psychiatric manifestations" ppt

Báo cáo y học: "Screening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lupus erythematosus with psychiatric manifestations" ppt

... interpretation of data MR carried out the ELISA experiments and participated in analysis of data CA performed the statistical analysis and the clinical associations AS participated in the analysis and ... used as second antibodies and incubated (100 µl/well) for hour at 20°C o-Phenylenediamine dihydrochloride (Sigma) was used as a substrate and absorbance was measured at 490 nm Means + standard ... Psychiatric Association; 1994 14 Margutti P, Delunardo F, Sorice M, Valesini G, Alessandri C, Capoano R, Profumo E, Siracusano A, Salvati B, Rigano R, et al.: Screening of a HUAEC cDNA library...

Ngày tải lên: 09/08/2014, 06:23

8 375 0

Bạn có muốn tìm thêm với từ khóa:

w