children youths and adolescents

Tài liệu Handbook of Clinical Sexuality for Mental Health Professionals docx

Tài liệu Handbook of Clinical Sexuality for Mental Health Professionals docx

... between children and their parents, patients and health-care professionals, clients and lawyers or accountants, and advice-seekers and clergy Two-sided intimacies are the basis of friendships and ... flow and a combination of plots and subplots, characters, and meaning Some stories unfold chronologically from beginning to end; others begin at the end and flash backward to illustrate and highlight ... business, and so forth, without compromising their sense of femininity A negative gender identity sense can lead to low self-esteem, avoidance of partnerrelated sex and intimacy, and social and emotional...

Ngày tải lên: 15/02/2014, 02:20

494 5,4K 1
DSM IV TR personality disorders dimensional profiles   beyond the five factor model

DSM IV TR personality disorders dimensional profiles beyond the five factor model

... the means and standard deviations of the 10 SPI facets for each of the 10 DSM-IV-TR PDs As in Miller et al (2001) and Lynam and Widiger (2001), facets with a mean score of and lower, or and higher ... that found in Lynam and Widiger 19 Using the same criteria as in Lynam and Widiger (2001; high rwg and low SD), agreement was best for avoidant, narcissistic and dependent PDs and worst for paranoid, ... item-total correlation and α for composite) as in Lynam and Widiger (2001), agreement was best for antisocial, narcissistic and compulsive PDs and worst for paranoid, schizotypal and dependent PDs...

Ngày tải lên: 04/10/2015, 17:05

97 445 0
Báo cáo y học: "Prevalence and age-of-onset distributions of DSM IV mental disorders and their severity among school going Omani adolescents and youths: WMH-CIDI findings" pot

Báo cáo y học: "Prevalence and age-of-onset distributions of DSM IV mental disorders and their severity among school going Omani adolescents and youths: WMH-CIDI findings" pot

... (lifetime and 12 month), their age-ofonset distributions and their severity (in the past 12 months cases) among the Omani adolescents and youths studying in the secondary schools Methodology Samples and ... classes ranging from grade to grade and their stream of study [13] In the first phase (phase 1), a screening of 2,739 male and 2,670 female adolescents and youths (total n = 5,409) with the General ... study of CAMDs [6] Current estimates indicate that as many as 7% to 22% of all children and adolescents are affected [7] and up to 50% of all adult mental disorders have their onset in adolescence...

Ngày tải lên: 13/08/2014, 18:21

11 412 0
Báo cáo khoa học: The dipeptidyl peptidase IV family in cancer and cell biology pot

Báo cáo khoa học: The dipeptidyl peptidase IV family in cancer and cell biology pot

... endothelial capillaries; by acinar cells of mucous and salivary glands and pancreas; by the uterus; and by immune organs such as thymus, spleen and lymph node [22–25] (Fig 2) Our recent study using ... hybridization and immunohistochemistry analyses on baboon and human tissues detected DP8 and DP9 in lymphocytes and epithelial cells in the gastrointestinal tract, skin, lymph node, spleen, liver and lung, ... of DP8 and DP9 immune function, and their potential as targets for inflammatory diseases As previously outlined, DP8 and DP9 are present in leucocytes and leucocyte DPIV family in cancer and cell...

Ngày tải lên: 06/03/2014, 09:22

19 468 0
Báo cáo khoa học: Extraenzymatic functions of the dipeptidyl peptidase IV-related proteins DP8 and DP9 in cell adhesion, migration and apoptosis doc

Báo cáo khoa học: Extraenzymatic functions of the dipeptidyl peptidase IV-related proteins DP8 and DP9 in cell adhesion, migration and apoptosis doc

... Kable and Devanshi Seth for advice This work was supported by National Health and Medical Research Council of Australia project grant 142607 to GWM and MDG and PhD scholarships to DMTY and XMW ... relatedness, DP8 and DP9 exert these differences in their cellular effects Therefore, these two proteins are likely to have different functions and ligands These data indicate that DP8 and DP9 have ... dephosphorylating p38 MAP kinase and b1-integrin [29], so the effects of DP8 and DP9 on p38, b1-integrin and DDR1 phosphorylation require examination Changes in TIMP2 and b-catenin expression may...

Ngày tải lên: 23/03/2014, 11:20

14 280 0
Báo cáo toán học: "Continued fractions related to (t, q)-tangents and variants" ppsx

Báo cáo toán học: "Continued fractions related to (t, q)-tangents and variants" ppsx

... = sinq (u) cosq (u) generalises for w = q r the Foata and Han version, and for w = −1 the Cieslinski version Our elementary approach can handle this situation as well: Set (w; q)2n+1 n σ0 (z) ... Tanq (z) = Sinq (z)/Cosq (z) As we know, q-tangents are good candidates for beautiful continued fraction expansions [6, 4, 7, 8]; and this is confirmed by the results of the previous section This ... coefficients and simple qidentities Now define (−1)n (−1; q)2n+1 σ0 := zn , (q; q)2n+1 n≥0 zn σ−1 := n≥0 (−1)n (−1; q)2n (q; q)2n the electronic journal of combinatorics 18(2) (2011), #P18 and, more...

Ngày tải lên: 08/08/2014, 14:23

7 251 0
Effect of angiotensin IV on the survival and toxicity of sulphur mustard treated mice

Effect of angiotensin IV on the survival and toxicity of sulphur mustard treated mice

... environment to work Emily and Siew Lai, for assistance and support with the animal work Fellow comrades from NUS, Yongjie and Eugene, for all their generous advice and pointers Family and friends, for ... Kwoon, and Dr Loke Weng Keong for their constant guidance, patience and academic advice in this project Colleagues from DSO, especially Joyce and Tracey, for their technical help, encouragement and ... their love, support and prayers! My fiancé, Ignatius, for being such a constant source of strength, patience and understanding I wouldn t have made it though without your love and support I thank...

Ngày tải lên: 05/10/2015, 19:02

108 269 0
Part IV: Advanced Tips and Tricks

Part IV: Advanced Tips and Tricks

... add a new menu command to a set, highlight the command you want on the Menu tab and click the Add button Adding a menu command to a set gives you one-click access to a command you’d normally ... midtones, and highlights in an image) When the Adjust Levels dialog box appears, you set the shadows, midtones, and highlights of the image by clicking and dragging the left, center, and right ... Specified Width, and enter a value between 0.00 mm and 2.00 mm in its text box • To thin out the lines, select Narrow to the Specified Width, and enter a value between 0.00 mm and 2.00 mm in its...

Ngày tải lên: 27/08/2012, 14:31

39 820 0
A study on idiomatic variants and synonymous idioms in english and vietnamese

A study on idiomatic variants and synonymous idioms in english and vietnamese

... Britain and Northern Ireland Great Britain is the largest island in the cluster of islands, or archipelago, known as the British Isles England is the largest and most populous division of the island ... Britain, making the South and East Wales is on the West and Scotland is to the North Northern Ireland is located in the Northeast corner of Ireland, the second largest island in the British Isles ... the birds and the bees - Body and bodily functions: at arm’s length - Buildings and construction: to drive someone up the wall - Character and appearance: as cold as ice - Children and babies:...

Ngày tải lên: 07/11/2012, 15:01

71 1,9K 12
Tài liệu Primer For Class Iii & Class Iv Milk Futures And Options Traders(pdf) pptx

Tài liệu Primer For Class Iii & Class Iv Milk Futures And Options Traders(pdf) pptx

... increased demand, mainly for cheese and cheese products, have brought about a price equilibrium between the supply of milk and the uses of milk Thus, any seasonal changes in the production or demand for ... Butter, Nonfat Dry Milk, and Dry Whey futures and options prices Released daily USDA NASS Web Site www.ams.usda.gov § Class III and Class IV cash settlement prices for Milk, and cash settlement prices ... easy entry into futures and options markets The Milk futures and options contracts trade each month, can be offset at any time, or can be held through contract expiration and be automatically offset...

Ngày tải lên: 21/12/2013, 01:20

15 375 0
Tài liệu Báo cáo khoa học: Mouse recombinant protein C variants with enhanced membrane affinity and hyper-anticoagulant activity in mouse plasma pptx

Tài liệu Báo cáo khoa học: Mouse recombinant protein C variants with enhanced membrane affinity and hyper-anticoagulant activity in mouse plasma pptx

... All other reagents and buffer components were commercially available and of highest the purity Mutagenesis, construction and stable expression of recombinant mouse protein C and variants Mutagenesis ... alignment from different species and mouse protein C variants used in the present study N-terminal Gla sequence (1–44) is shown and defined between the propeptidase and chymotrypsin cleavage sites ... abilities (Fig 3A–C) Noticeably, mutants II and III stand out from the other proteins analyzed, obtaining the highest responses for all membrane types Mutants V and VII also show a significant binding-response...

Ngày tải lên: 18/02/2014, 06:20

17 496 0
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx

Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx

... Mutations and amplification of the androgen receptor gene, without loss of gene expression, play a key role in the development of advanced, androgen-independent prostate cancer [4] Methylation of the androgen ... human and mouse linker histones Speciation events are indicated by blue dots and gene duplication by red dots HIST1H1C and HIST1H1E are the genes that code for human linker histones H1.2 and H1.4, ... phosphorylations on H1.2 at Thr31 and Ser36, on H1.3 at Ser37, and on H1.4 at Ser2, Thr4, Thr18, Ser27, and Ser36 In comparing the work of Wisniewski et al [43] (Table 1) and Garcia et al [42], it can...

Ngày tải lên: 18/02/2014, 08:20

13 633 0
Tài liệu MASTER OF BUSINESS ADMINISTRATION (MBA) II TO IV SEMESTERS (FULL TIME) CURRICULUM AND SYLLABUS doc

Tài liệu MASTER OF BUSINESS ADMINISTRATION (MBA) II TO IV SEMESTERS (FULL TIME) CURRICULUM AND SYLLABUS doc

... Basics Understanding of Brands – Definitions - Branding Concepts – Functions of Brand Significance of Brands – Different Types of Brands – Co branding – Store brands UNIT II BRAND STRATEGIES ... Brand Management process – Building a strong brand – Brand positioning – Establishing Brand values – Brand vision – Brand Elements – Branding for Global Markets – Competing with foreign brands ... BRAND COMMUNICATIONS Brand image Building – Brand Loyalty programmes – Brand Promotion Methods – Role of Brand ambassadors, celebraties – On line Brand Promotions UNIT IV BRAND EXTENSION Brand...

Ngày tải lên: 18/02/2014, 08:20

34 537 0
Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

... of the MCAD mutants, K364R and R256T, and for the wild-type enzyme, in E coli cells grown both at 31 °C and 37 °C, and the effect on activity (ferricenium assay), and tetramer assembly (as determined ... protein K364R and wild-type MCAD (WT) (B) Comparison of the activity levels of purified K364R and wildtype MCAD, as determined by both the ferricenium and ETF assays (error bars indicate standard deviation ... for the Amicon Centricon device were purchased from Millipore Ireland BV (Cork, Ireland) Mutagenesis and subcloning of R256T and K364R The genes for the mutant MCAD proteins were overexpressed...

Ngày tải lên: 20/02/2014, 02:21

9 533 0
Tài liệu Báo cáo khoa học: Distribution of class I, III and IV alcohol dehydrogenase mRNAs in the adult rat, mouse and human brain ppt

Tài liệu Báo cáo khoa học: Distribution of class I, III and IV alcohol dehydrogenase mRNAs in the adult rat, mouse and human brain ppt

... specificity Materials and methods Animals Sprague–Dawley rats (two male and two females, 250– 270 g) and C57B1/6 mice (two adult males and two adult females, one wild-type and one Adh4 knock-out ... (Belmont, MA, USA) and the Netherlands Brain Bank (Amsterdam, The Netherlands) Blocks of cortex, anterior amygdala, striatum and midbrain from four nondemented control subjects (three male and one female, ... 4.5 and 23.9 h), as well as cerebellum from four further normal controls (two males and two females, age range (59–78 years), PMI between 59 and 78 h) were included in the study The Brain and...

Ngày tải lên: 21/02/2014, 00:20

11 604 0
Tài liệu Báo cáo khoa học: Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents pptx

Tài liệu Báo cáo khoa học: Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents pptx

... sieve and showed a broad electrophoretic band mainly in the range 70±110 kDa, which could be converted into the monomer and dimer bands after treatment with chondroitinase ABC (Fig 2, lanes and ... Kidney (A and B) and skeletal muscle (C and D) from 3-week-old Lamb2 +/+ and ±/± littermates were stained with anti-b2 serum In the control, basement membranes throughout the kidney and skeletal ... and GTCACTCGAGCTAAAGGCC CGTCTGGTGAATCAAG, respectively, and for b2 GTC AGCTAGCCCGTCCCTGTGACTGTGATG and GTC ACTCGAGCTAGGCTTGACAGCCTGCAGGG, respectively They were used for ampli®cation by PCR and...

Ngày tải lên: 21/02/2014, 03:20

12 509 0
SUBCOURSE OD1750EDITION AREFRIGERATION AND AIR CONDITIONING IV potx

SUBCOURSE OD1750EDITION AREFRIGERATION AND AIR CONDITIONING IV potx

... direct expansion (D/X), and (3) reheat We will discuss the application of these coils, their use and control, and the valves and dampers which control the flow of water and air D/X Coil In equipment ... and Absorption System Centrifugal Systems and Water Treatment Centrifugal Water Pumps and Electronic Control Systems Unless otherwise stated, whenever the masculine gender is used, both men and ... Disconnect the valve and plug the tube ends Remove the screen and clean it with a recommended cleaning solvent After the screen is clean and dry, reinstall it in the valve and connect the valve...

Ngày tải lên: 05/03/2014, 19:20

161 304 0
Báo cáo khoa học: Assembly and molecular mode of action of the Helicobacter pylori Cag type IV secretion apparatus doc

Báo cáo khoa học: Assembly and molecular mode of action of the Helicobacter pylori Cag type IV secretion apparatus doc

... lack the cagPAI and are less virulent The Cag secretion system is responsible for the induction of a pronounced pro-inflammatory response in vitro and in vivo, and the translocation and subsequent ... cagPAI and the properties of both conserved and unique components of the Cag-T4SS, together with potential implications for the current understanding of its mode of action The cagPAI and the ... additional components, CagM and Cagd Both proteins have N-terminal signal sequences and were shown to be associated with the outer membrane and to interact with CagT, with CagX, and with each other [22,33]...

Ngày tải lên: 06/03/2014, 00:21

10 393 0
Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

... be distinguished Helices B, E, F and H, arranged in an up -and- down topology, form the structural core, whereas the short helices C, D and G on one side, and A, I and J on the other, represent types ... glutamate and aspartate residues confined to the portion of the molecule involving a-helix A, the nearby loop, the first and last turns of helices E and F, and the C-terminus helices I and J In ... b-sheet flanked by a-helices Five b-strands, labelled from A to E, run all contiguous The N-terminus of the monomer includes strand A, an a-helix and a long stretch, and the C-terminal portion includes...

Ngày tải lên: 06/03/2014, 00:21

9 496 0
Báo cáo khoa học: Assembly of nuclear DNA-encoded subunits into mitochondrial complex IV, and their preferential integration into supercomplex forms in patient mitochondria doc

Báo cáo khoa học: Assembly of nuclear DNA-encoded subunits into mitochondrial complex IV, and their preferential integration into supercomplex forms in patient mitochondria doc

... proteinase K (Fig 1B, lanes and 6), their dependence on the membrane potential (Dwm) for this protection (Fig 1B, lanes and 7), and, in the case of Cox4-1, Cox6a and Cox7a, processing of their ... α-complex I BN-PAGE 0.65% DDM A kDa and human disease, and also to assess the possible involvement of Surf1 in the formation and assembly of the LSI complex BN-PAGE and western blot analysis of mitochondria ... digitonin-containing buffer and subjected to BN-PAGE and phosphorimaging (B) 35 S-labeled complex IV subunits were incubated with mitochondria from patient for 10 and 60 and treated as described...

Ngày tải lên: 07/03/2014, 00:20

13 314 0
w