checking the flashback status of a database

... note that the PAS domain of the phosphorelay histidine kinase A of Bacillus subtilis was recently shown to be a catalytic ATP-binding domain [31] As the PAS domain of BvgS contains a putative ATP ... the Bordetella pertussis BvgAS signal transduction cascade Proc Natl Acad Sci USA 91, 1163–1167 Utsumi, R., Katayama, S., Taniguchi, M., Horie, T., Ikeda, M., Igaki, S., Nakagawa, H., Miwa, A ... of a cell, and it was recently shown that they can bind small ligands such as FAD and ATP [13,29,31] In fact, mutations in this domain have been reported which cause either the inactivation of...

Ngày tải lên: 17/03/2014, 23:20

... However, the depressive features of heroin addicts are associated with anxiety rather than with suicidality, and a dominant Page of (page number not for citation purposes) Annals of General Psychiatry ... addition, all available clinical records were carefully examined Inquiry on temperamental attributes was made about the habitual state of the patient during periods free of affective episodes; this was ... on the basis of the highest z-scores obtained for each factor (dominant factor) We compared clinical features among the various dominant factor groups by means of one-way ANOVA followed by the...

Ngày tải lên: 08/08/2014, 23:20

... 1999), and a pathological examination was performed on organs sampled by a pathologist at the abattoir The following material was collected for histopathology from each animal at the abattoir; samples ... thoroughly the infection status in this herd at the time of slaughter, by the use of IFN-γ immunoassay, and serological, pathological, and bacteriological examination Material and Methods Farm management ... serological, pathological and bacteriological examination of 45 animals in a dairy herd Age (Years) Pathology3 Bacteriology faeces/organs No of animals ++ ++ Granulomatous enteritis Acid fast rods...

Ngày tải lên: 12/08/2014, 15:21

... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...

Ngày tải lên: 27/10/2012, 16:51

... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...

Ngày tải lên: 24/12/2013, 01:17

... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...

Ngày tải lên: 19/02/2014, 16:20

... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...

Ngày tải lên: 19/02/2014, 19:20

... data from the database These operators make calls to fetch data from the DBMS’ Transactional Storage Manager (Figure 1.1, bottom), which manages all data access (read) and manipulation (create, ... in a database system This also serves as an overview of the remaining sections of the paper Consider a simple but typical database interaction at an airport, in which a gate agent clicks on a ... in all three DBMS models is that the buffer pool is a large shared data structure available to all database threads and/or processes When a thread needs a page to be read in from the database, ...

Ngày tải lên: 20/02/2014, 05:21

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...

Ngày tải lên: 21/02/2014, 01:21

... p53 pathways [32–35] which can be visualized by the appearance of charac- teristic DNA damage foci using an antibody to the damage response protein cH2AX [36], or by a significant population of ... little data on haematological cancers Notable findings include that of single-agent activity for RHSP4 in a metastatic melanoma model, as well as in a melanoma line resistant to the platinum drug ... from a number of assays The most important are: (a) high-affinity in vitro telomeric quadruplex binding, with a Ka value of at least 106 m)1; (b) a low level of binding to duplex DNA, with a Ka value...

Ngày tải lên: 06/03/2014, 09:22

... ELEMENTS OF A BROADBAND POLICY A A National Policy for an Interstate Service The Interstate Nature of Broadband—Based on the nature of the technology and the reality of the market, broadband service ... resemblance of a fair market price Further FCC decisions on the regulatory treatment of cable and wire-line broadband services are around the corner The FCC has already ruled that the cable broadband falls ... eliminate roadblocks of a regulatory character which are constantly being placed in the way of that industry by the FCC, the Department and occasionally by State agencies Those companies that have...

Ngày tải lên: 07/03/2014, 11:20

... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...

Ngày tải lên: 07/03/2014, 14:20

... 11/2/2011 11/2/2011 11/2/2011 12/5/2011 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 0.23 1.50 0.75 1.50 1.50 1.50 0.45 1.50 ... Vincent and the Grenadines IDB Jamaica IDB Caribbean IBRD Niger IBRD Samoa IBRD Samoa IBRD Dominica IBRD Haiti ADB Cambodia ADB Cambodia ADB Cambodia ADB Cambodia ADB Cambodia ADB Cambodia ADB Cambodia ... Cambodia ADB Nepal IBRD St Lucia IBRD Nepal IBRD Zambia IBRD Zambia ADB Bangladesh IDB Bolivia IBRD Bolivia IBRD Jamaica ADB Tajikistan Projects IBRD Tajikistan IBRD Grenada IBRD Grenada IBRD...

Ngày tải lên: 07/03/2014, 16:20

... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...

Ngày tải lên: 08/03/2014, 02:21

... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...

Ngày tải lên: 08/03/2014, 09:20

... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a...

Ngày tải lên: 08/03/2014, 22:20

... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...

Ngày tải lên: 08/03/2014, 22:20

Ngày tải lên: 12/03/2014, 00:21

... establishes the Academy as a private, nonprofit, self-governing membership corporation The Council has become the principal operating agency of both the National Academy of Sciences and the National Academy ... for the impact of ethical drugs on public health, but only few data are available to quantify the additional importance of pharmaceuticals for private health These private health benefits are often ... by the Governing Board of the National Research Council, whose members are drawn from the Councils of the National Academy of Sciences, the National Academy of Engineering, and the Institute of...

Ngày tải lên: 14/03/2014, 11:20

... studying the influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are ... Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation of laser parameters influences clearly on the transformation ... reveals that the increase of one mode photon density caused in the decrease of the other one Fig 1a Gain coefficient α1 varies Fig 1b Gain coefficient α2 varies D.V Hoang, M.H Hanh / VNU Journal...

Ngày tải lên: 14/03/2014, 13:20