chapter 1 1 6 programming in cgi

asterisk gateway interface 1 4 and 1 6 programming sample chapter 4 a primer to agi asterisk gateway interface

asterisk gateway interface 1 4 and 1 6 programming sample chapter 4 a primer to agi asterisk gateway interface

... snippets into the programming/ scripting language of your choice Chapter will deal with your first AGI script; think of it as your "Hello-World" program from "Programming 10 1" Chapter will introduce ... Technology Institute in Haifa Nir quickly became involved in organizing open source venues and events, promoting the use of Linux and open source technologies in Israel In 19 98, Nir started working ... can buy Asterisk Gateway Interface 1. 4 and 1. 6 Programming from the Packt Publishing website: http://www.packtpub.com/asterisk-gatewayinterface -programming/ book Free shipping to the US, UK, Europe...

Ngày tải lên: 05/11/2015, 08:33

22 494 0
Tài liệu Programming the Be Operating System-Chapter 1: BeOS Programming Overview ppt

Tài liệu Programming the Be Operating System-Chapter 1: BeOS Programming Overview ppt

... that involve the window You’ll be pleased to find that the work of maintaining a window’s thread and of keeping a window informed of system messages (such as a mouse button click in the window) ... to include any BeOS Programming Fundamentals 21 window-closing code in my SimpleWindow class if my goal was only to have a mouse button click in the close button result in the closing of the window ... CodeWarrior BeIDE programming environment is introduced later in this chapter and discussed in more detail in Chapter 2, BeIDE Projects Deriving a class from BWindow A Be program that uses windows could...

Ngày tải lên: 26/01/2014, 07:20

30 461 0
Geophysics lecture chapter 1 the earth in the solar system

Geophysics lecture chapter 1 the earth in the solar system

... →2 06 Pb , 235 207 232 U→ 208 Th → λ238 = 1. 55 × 10 10 yr 1 , T1/2 = 4.5 By (1. 29) Pb , λ235 = 9.85 × 10 10 yr 1 , T1/2 = 0.7 By (1. 30) Pb , λ232 = 4.95 × 10 11 yr 1 , T1/2 = 14 By (1. 31) Using ... mechanism operating in an atom of a given element We may rewrite dN = −λ dt, N (1. 16) and integrating both sides of (1. 16) we find ln N = −λt + c, (1. 17) 1. 6 RADIOACTIVE DECAY 13 where the constant ... �2 (1. 5) is the planetary velocity, is also conserved It is possible to rewrite (1. 1) in terms of the mass of the sun and doing so yields L = mr2 ω = (GMs )1/ 2 mr1/2 (1. 6) By integrating (1. 6) ...

Ngày tải lên: 04/12/2015, 00:25

27 310 0
Chapter 9: COUNTER/TIMER PROGRAMMING IN THE 8051

Chapter 9: COUNTER/TIMER PROGRAMMING IN THE 8051

... Jeng Finding values to be loaded into the timer Assuming XTAL =11 .0592MHz from Example 9 -10 1. Divide the desired time delay by 1. 085μs 2.Perform 65 5 36- n, where n is the decimal value we got in Step ... program in mode 1. Load the TMOD value 2.Load registers TL and TH 3.Start the timer (SETB TR0 or SETB TR1) 4.Keep monitoring the timer flag (TF) 5.Stop the timer (CLR TR0 or CLR TR1) 6. Clear the ... MuDer Jeng ©2002 MuDer Jeng Mode programming 1. Loaded value into TL and TH 2.”SETB TR0” for timer ;”SETB TR1” for timer 3.If TF (timer flag) = high “CLR TR0” or “CLR TR1” 4.Reloaded TH and TL value,...

Ngày tải lên: 27/10/2013, 19:15

38 460 0
Tài liệu động cơ FORD 6.4L P1- Chapter 1

Tài liệu động cơ FORD 6.4L P1- Chapter 1

... degas return coolant before being sent into the front cover, just above the main coolant inlet from the radiotor 26 17 Coo ling S ystem COOLANT IN (from block) Cooling System Flow: Back of Front ... Sleeve • The 6. 4L Power Stroke uses stainless steel injector sleeves to seal coolant from the injector and to transfer heat from the injector to the coolant Injector Sleeve • The injector sleeve ... cylinder walls and cylinder heads (there are different sized orifices pressed into the crankcase in these two passages) • The third passage routes coolant to the oil cooler via a passage in the...

Ngày tải lên: 20/10/2012, 08:08

5 692 13
Tài liệu Chapter 1 - Living in a Network Centric World CCNA Exploration 4.0 pptx

Tài liệu Chapter 1 - Living in a Network Centric World CCNA Exploration 4.0 pptx

... enrich student learning experiences Courses delivered using network or Internet resources are often called online learning experiences, or e-learning Online courses can contain voice, data, and ... manner Online courseware and delivery offer many benefits to businesses such as: – Current and accurate training materials – Availability of training to a wide audience – Consistent quality of instruction ... Supporting the Way We Learn • • Online learning opportunities can decrease time-consuming and costly travel yet still ensure that all employees are adequately trained to perform their jobs in a...

Ngày tải lên: 12/12/2013, 14:15

41 730 0
Tài liệu The Insider’s Guide to PR: Chapter 1 WORKING IN A PR CONSULTANCY doc

Tài liệu The Insider’s Guide to PR: Chapter 1 WORKING IN A PR CONSULTANCY doc

... work in a consultancy than in- house The fact that you have a variety of clients helps you learn new approaches to day-to-day PR techniques; writing, selling -in stories, managing staff, working ... is all invaluable experience in recognising where PR fits into the broader marketing picture • Derek Harris Senior Account Manager Republic PR and Business graduate • Social Life – Having explored ... offers newcomers to the industry an excellent grounding in fundamental PR practices Graduate trainee programmes, in particular, are an excellent platform from which to gain varied experience with...

Ngày tải lên: 13/12/2013, 04:15

2 683 1
Tài liệu Embedding Perl in HTML with Mason Chapter 1: Introduction pdf

Tài liệu Embedding Perl in HTML with Mason Chapter 1: Introduction pdf

... server-side include (SSI) mechanism, as in Example 1- 1, Example 1- 2, and Example 1- 3 Executing mainpage.mas will produce a full page of HTML with the header and footer inserted in place Example 1- 1 header.mas ... 5 .6 .1 is recommended Instructions for installing Perl are contained in the INSTALL file, included with the distributions If you're on some variety of Windows, you may find it much easier to install ... feel very simple If you're interested in learning more about alternatives to Mason, you might be interested in another book from O'Reilly and Associates, Inc., CGI Programming with Perl, written...

Ngày tải lên: 14/12/2013, 12:15

31 463 0
Tài liệu Socket Programming in C# ­ Part 1 – Introduction pptx

Tài liệu Socket Programming in C# ­ Part 1 – Introduction pptx

... System.Net.IPAddress.Parse( "10 .10 .10 1.200"); System.Net.IPEndPoint remoteEP = new IPEndPoint (iAdd,82 21) ; m_socClient.Connect (remoteEP); These three lines of code will make a connection to the remote host running on ... on computer with IP 10 .10 .10 1.200 and listening at port 82 21 If the Server is running and started (listening), the connection will succeed If however the server is not running an exception called ... (AddressFamily.InterNetwork,SocketType.Stream ,ProtocolType.Tcp ); // get the remote IP address IPAddress ip = IPAddress.Parse ( "10 .10 .12 0 .12 2"); int iPortNo = 82 21; //create the end point IPEndPoint ipEnd...

Ngày tải lên: 18/01/2014, 08:20

10 508 2
Tài liệu Practical mod_perl-CHAPTER 1: Introducing CGI and mod_perl pptx

Tài liệu Practical mod_perl-CHAPTER 1: Introducing CGI and mod_perl pptx

... QUERY_STRING => HTTP_USER_AGENT => Mozilla/5.0 Galeon /1. 2 .1 (X 11; Linux i6 86; U;) Gecko/0 SERVER_ADDR => 12 7.0.0 .1 SCRIPT_NAME => /cgi- bin/env.pl SCRIPT_FILENAME => /home/httpd /cgi- bin/env.pl ... Mozilla/5.0 Galeon /1. 2 .1 (X 11; Linux i6 86; U;) Gecko/0 So you can see how easy it is to fool a naïve CGI programmer into thinking we’ve used Galeon as our client program SERVER_ADDR => 12 7.0.0 .1 SCRIPT_NAME ... http://hoohoo.ncsa.uiuc.edu /cgi/ • The HTTP /1. 1 standard: http://www.w3.org/Protocols/rfc2 61 6 /rfc2 61 6 .html • Various information about CGI at the W3C site: http://www.w3.org /CGI/ • MIME Media Types:...

Ngày tải lên: 21/01/2014, 06:20

22 435 0
Tài liệu Chapter 1:Introduction- Web Client Programming with Perl doc

Tài liệu Chapter 1:Introduction- Web Client Programming with Perl doc

... wanted to print an entire document that had been split up into individual files, and had to select Chapter 1, print, return to the contents page, select Chapter 2, etc Is there a way to print the ... Information Superhighway, Internet, the Web, Mosaic, etc (For a while all these words were used interchangeably, much to the chagrin of anyone who had been using the Internet for years.) In 19 94, ... web maintainers Worst of all, web clients could cause data integrity problems on servers by feeding bad data to Common Gateway Interface (CGI) programs that don't bother to check for proper input...

Ngày tải lên: 26/01/2014, 07:20

10 375 0
Tài liệu Báo cáo khoa học: Modulation of cyclin D1 and early growth response factor-1 gene expression in interleukin-1b-treated rat smooth muscle cells by n-6 and n-3 polyunsaturated fatty acids pdf

Tài liệu Báo cáo khoa học: Modulation of cyclin D1 and early growth response factor-1 gene expression in interleukin-1b-treated rat smooth muscle cells by n-6 and n-3 polyunsaturated fatty acids pdf

... MAPK kinase (MEK) inhibitor, U 012 6 U 012 6 completely inhibited the cyclin D1 promoter activity in AA-pretreated SMC incubated with IL-1b and reduced it in cells incubated with fetal bovine serum ... E.S & Collins, T (2000) High-level expression of Egr -1 and Egr-1inducible genes in mouse and human atherosclerosis J Clin Invest 10 5, 65 3 66 2 15 Terano, T., Shiina, T & Tamura, Y (19 96) Eicosapentaenoic ... monoclonal anti-(cyclin D1) Ig There was little cyclin D1 protein in SMC stimulated with IL-1b for 24 h (Fig 1C) Incorporating AA before stimulation by IL-1b increased the cyclin D1 concentration,...

Ngày tải lên: 19/02/2014, 16:20

12 499 0
Chapter 1 – Introduction to Computers and C++ Programming pot

Chapter 1 – Introduction to Computers and C++ Programming pot

... 2 Chapter – Introduction to Computers and C++ Programming Outline 1. 16 1. 17 1. 18 1. 19 1. 20 1. 21 1.22 1. 23 1. 24 1. 25 1. 26 History of the Internet History of the World ... variable – Binary operator (two operands) – Example: sum = variable1 + variable2; © 2003 Prentice Hall, Inc All rights reserved 1 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 // Fig 1. 6: fig 01_ 06. cpp ... Hall, Inc All rights reserved 41 10 11 12 // Fig 1. 5: fig 01_ 05.cpp // Printing multiple lines with a single statement #include // function main begins program execution Using newline...

Ngày tải lên: 10/03/2014, 06:20

61 1,5K 0
A Problem Course in Mathematical Logic Version 1.6 doc

A Problem Course in Mathematical Logic Version 1.6 doc

... 81 Chapter 13 Recursive Functions 87 Chapter 14 Characterizing Computability 95 iii iv CONTENTS Hints for Chapters 10 14 10 1 Part IV Incompleteness 10 9 Chapter 15 Preliminaries 11 1 Chapter 16 ... Chapter 16 Coding First-Order Logic 11 3 Chapter 17 Defining Recursive Functions In Arithmetic 11 7 Chapter 18 The Incompleteness Theorem 12 3 Hints for Chapters 15 18 12 7 Appendices 13 1 Appendix A ... Deductions 11 Chapter Soundness and Completeness 15 Hints for Chapters 1 4 17 Part II First-Order Logic 21 Chapter Languages 23 Chapter Structures and Models 33 Chapter Deductions 41 Chapter Soundness...

Ngày tải lên: 14/03/2014, 17:20

166 487 0
Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt

Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt

... sll1 868 slr13 56 sll12 61 sll1749 slr1 463 sll1099 slr 119 8 sll 16 21 Unidentified Unidentified Spot no on 2D-PAGE Light induciblea 15 21 s 5, 32 16 29 29 22 17 s s s s s s s s s 19 24 s s 18 s 10 s 11 ... sll0587, sll1275 12 .0 370 45.9 7.4 2.8 2.9 13 .3 8.8 363 31. 7 3.2 12 .1 1.2 12 .2 9.9 204 61 . 6 5.7 12 .2 3 .1 10.2 a ± ± ± ± ± ± ± 2.9 26 4.5 0.8 0.8 1. 3 2.4 ± ± ± ± ± ± ± 2 .6 17 5 .6 1. 2 3.4 0.9 1. 4 ± ± ... fbaA in Synechocystis Autotrophic conditions A kDa B pI LAHG conditions 250 75 50 25 C Dark heterotrophic conditions E 14 15 16 13 19 18 22 21 20 32 25 26 27 28 10 11 12 23 30 D kDa Δsll1330...

Ngày tải lên: 16/03/2014, 04:20

12 395 0
Báo cáo khoa học: Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco docx

Báo cáo khoa học: Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco docx

... 9.85 10 .49 10 .69 11 . 31 205 , 16 1 ,11 7 233 , 16 1 ,11 7 233 , 16 1 ,18 9 ,11 7 18 9 ,11 7 2,3,4 ,6 2,4 ,6 2,3,4 2,4 Terminal-Glc 3-linked-Glc 6- linked-Glc 3 ,6- linked-Glc 0.97 1. 94 1. 16 1. 00 FEBS Journal 273 (20 06) ... Time (min) 25 10 15 20 Time (min) 25 W a te TBC -1 1000 Co ntr o l 2799 [GDP =17 +Na]+ 2474 [GDP =15 +Na]+ B 263 6 [GDP = 16 +Na]+ 19 87 [GDP =12 +Na]+ 18 25 [GDP =11 +Na]+ 15 00 [GDP=9+Na]+ 20 214 9 [GDP =13 +Na]+ ... (R)GCTTAGGTATTCAGAAACAGGTGGC 66 5 3 56 3 36 3 01 410 302 310 447 56 58 56 56 56 50 56 56 FEBS Journal 273 (20 06) 24 21 24 31 ª 20 06 The Authors Journal compilation ª 20 06 FEBS 2429 Novel b-glucan elicitor from A alternata 10 2...

Ngày tải lên: 23/03/2014, 11:20

11 358 0
Fate of Pharmaceuticals in the Environment and in Water Treatment Systems - Chapter 1 pot

Fate of Pharmaceuticals in the Environment and in Water Treatment Systems - Chapter 1 pot

... 20 22 39 12 8 12 9 12 1 11 7 20 11 9 10 2 11 2 20 11 6 10 2 20 11 6 10 2 11 2 50 11 6 11 9 20 22 39 77 10 2 11 2 Fate of Pharmaceuticals in the Environment and in Water Treatment Systems TABLE 1. 1 (Continued) ... 0 .14 nd-0. 26 0.07 max 0.03-0.29 nd-0.25 0.009-0.035 nd-0.057 0 .14 max nd -1 (nd) 0.008 max 0.028-0 .12 Reference 20 11 6 10 2 11 2 20 11 6 10 2 11 2 20 11 6 10 2 11 2 50 14 7 11 6 11 9 77 10 2 21 149 11 2 Environmental ... nd-0 .17 nd-0.075 nd-0.024 0. 263 max 0.0002-0. 0 16 0.044-0 .13 20 36 40 77 13 1 10 2 13 2 11 2 nd-0.22 (nd) nd-0.0 76 nd-0 . 16 0 .19 2 only 0 .1 max nd-8 (0.89) nd -1. 6 4.3 max 20 11 6 13 3 13 1 10 2 20 11 6 10 2...

Ngày tải lên: 18/06/2014, 16:20

61 532 1
Wastewater Purification: Aerobic Granulation in Sequencing Batch Reactors - Chapter 1 pptx

Wastewater Purification: Aerobic Granulation in Sequencing Batch Reactors - Chapter 1 pptx

... 4.3) 36 (± 4 .6) 34 (± 3 .1) ~ 54.3 (± 6. 3) 54.7 (± 8.4) 54 .6 (± 5.5) 56 .1 (± 7 .6) 1. 0 01 1. 01 (± 0.0 01) 1. 01 (± 0.0 01) ~ 8.4 (± 1. 0) 9.5 (± 1. 5) 11 .2 (± 1. 3) 12 .3 (± 1. 6) 49.4 81. 1 (± 4 .1) 84.2 (± ... Concentrations 13 Aspect/Roundness 0.80 COD (mg L 1) 500 10 00 2000 3000 0.75 Roundness 0.70 0 .66 0 .66 0 .64 Aspect Ratio 0 .65 (±0.009) 0 .65 (±0. 0 16 ) 0 .64 (±0. 019 ) 0 .66 (±0. 018 ) 0.70 0 .65 0 .60 10 00 2000 ... Francis Group, LLC 40 16 0 35 15 0 19 14 0 30 13 0 25 12 0 20 11 0 15 10 0.00 10 0 0.05 0 .10 0 .15 0.20 0.25 0.30 Sour(COD) (mg O2 g 1 SS h 1) Sour(NH4+) and Sour (NO2–) (mg O2 g 1 SS h 1) Aerobic Granulation...

Ngày tải lên: 18/06/2014, 16:20

32 376 0
AEROSOL CHEMICAL PROCESSES IN THE ENVIRONMENT - CHAPTER 1 pot

AEROSOL CHEMICAL PROCESSES IN THE ENVIRONMENT - CHAPTER 1 pot

... L829/frame/ch 01 Page Monday, January 31, 2000 2:20 PM Aerosol Chemical Processes in the Environment 14 aed size distribution 12 Frequency (%) 10 15 25 35 45 55 65 75 aed (nm) 85 95 10 5 11 5 12 5 More ... nitro-bacteria living and reproducing in © 2000 by CRC Press LLC L829/frame/ch 01 Page 16 Monday, January 31, 2000 2:20 PM 16 Aerosol Chemical Processes in the Environment FIGURE 1. 12 Photographs ... recent (19 94) black carbon data with those obtained in 19 85 and 19 86 in the urban area of Vienna, Austria, The Sci Total Environ., 18 9 /19 0, 275, 19 96 33 Trier, A., Submicron particles in urban...

Ngày tải lên: 18/06/2014, 19:20

35 382 0
w