... The amount of data and the speed at which it must be transmitted – The cost of the media and installation 17 Local Area Network (LAN) Local Area Network (LAN) An individual network usually spans ... Frame Header IP Header Data App TCP Header Header Frame Trailer Data Message: Data Multiple protocols 26 Multiple protocols (encapsulated) HTTP Header Protocols Frame Header IP Header Data App TCP ... Data App TCP Header Header Frame Trailer Data Encapsulation – Process of adding a header to the data or any previous set of headers Decapsulation – Process of removing a header 27 Example: Protocol...
Ngày tải lên: 01/04/2014, 12:20
... escape characters instead of triple quotes \n is a carriage return, and \t is a tab character split without any arguments splits on whitespace So three spaces, a carriage return, and a tab character ... make an instance evaluate to false You'll learn all about classes and special methods in Chapter If all values are true in a boolean context, and returns the last value In this case, and evaluates ... okay, because a lambda function is always true in a boolean context (That doesn't mean that a lambda function can't return a false value The function is always true; its return value could be anything.)...
Ngày tải lên: 14/12/2013, 14:15
CHAPTER 4: THE CONCEPT OF MEASUREMENT IN THE MARKETING RESEARCH docx
... (Measure scale) In fact, to have a comprehensive vision, each question usually applies a measure scale for these answers, or a total measure scale for that all 18 Three standards of a measurement ... be meanless 16 4.4 The Ratio scale The Ratio scale has all of particularity of the interval scale Moreover, the point in the ratio scale is a value "true“ So we can use division to calculate the ... widely Many Ratio scales , the meaning is deeper than three Ratio scales before 17 4.4 The Ratio scale In general the variables used interval scale and ratio scale, we can determine the value of...
Ngày tải lên: 09/07/2014, 17:20
Báo cáo sinh học: " A linear programming approach for estimating the structure of a sparse linear genetic network from transcript profiling data" pdf
... is regulated often by a small number of other genes [3,4] so a reasonable representation of a network is a sparse graph A sparse graph is a graph parametrized by a sparse matrix W, a matrix with ... the class of linear models, the abundance value of a gene is treated as a weighted sum of the abundance values of other genes A high-dimensional transcript profile is a vector of abundance values ... networks Analysis of the statistical and topological properties of learned LP-SLGNs may have practical value; for example, genes with high random walk betweenness, a measure of the centrality of a node...
Ngày tải lên: 12/08/2014, 17:20
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx
... the 4-kDa peptide N-terminal primer: 5¢-AACCATGGCTAAAGCAGATTGTAATGG TGCATGT-3¢; the 4-kDa peptide C-terminal primer: 5¢-AAGAATTCTTATTATCCAGTTGGATGTATGCA GAA-3¢ The amplified sequence was cloned ... were amplified by PCR strategy using the azuki bean and mung bean genomic DNAs as templates and the synthetic primers legF1 (5¢-AGC AGCAGATTGTAATGGTG-3¢) and legR1 (5¢-CAGC ACTTCAGAATCAGAGTC-3¢) ... with crystal structure Biochemistry 29, 10545–10555 21 Nagata, K., Hatanaka, H., Kohda, D., Kataoka, H., Nagasawa, H., Isogai, A. , Ishizaki, H., Suzuki, A & Inagaki, F (1995) Threedimensional solution...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo y học: "The impact of study design and diagnostic approach in a large multi-centre ADHD study. Part 1: ADHD symptom patterns" ppsx
... M, Manor I, et al: Partial Replication of a DRD4 Association in ADHD Individuals Using a Statistically Derived Quantitative Trait for ADHD in a Family-Based Association Test Biological Psychiatry ... Plomin, Ian Craig and Eric Taylor Chief Investigators at each site are Rafaela Marco, Nanda Rommelse, Wai Chen, Henrik Uebel, Hanna Christiansen, Ueli C Müller, Cathelijne Buschgens, Barbara Franke, ... R01MH62873 and R01MH081803 to S.V Faraone The IMAGE site Principal Investigators are Philip Asherson, Tobias Banaschewski, Jan Buitelaar, Richard P Ebstein, Stephen V Faraone, Michael Gill, Ana Miranda,...
Ngày tải lên: 11/08/2014, 15:22
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
... behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... support to MFIs amongst lower income populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower ... populated and largest metropolitan city of Pakistan, Karachi The city of Karachi comprises a diverse The sample size was drawn from three towns of Karachi, which included Landhi, Korangi, and Orangi...
Ngày tải lên: 06/09/2013, 05:48
the meaning and structure of a narrative a systemic functional analysis
... the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... explore the meaning and structure of Torquay? But I said Turkey! as a text The analysis is based on the framework of Hallidays (1994)An Introduction to Functional Grammar, Halliday and 21 Hasans (1997) ... Re-examine some of the most important issues related to the experiential aspect of functional grammar Analyze the meaning and structure of a narrative based on the systemic functional analysis...
Ngày tải lên: 07/09/2013, 13:48
the book of css3 - a developer's guide to the future of web design - by peter gasston
... Library of Congress Cataloging-in-Publication Data A catalog record of this book is available from the Library of Congress No Starch Press and the No Starch Press logo are registered trademarks of ... range of browsers has appeared to compete for users, and this plethora of choice has led to a features arms race One beneficiary of that arms race has been CSS3 Each of the browsers wants to offer ... Media Queries there’s a great gallery online at http://www.mediaqueri.es/, which showcases some of the better examples of what’s possible Syntax A Media Query sets a parameter (or series of parameters)...
Ngày tải lên: 20/09/2013, 09:09
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc
... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ability/neg ... relational was III Senser mental see Existent relational were Actor material descended Actor material landed Actor material put on Goal Actor material opened Goal Actor material climbed 10 Actor material...
Ngày tải lên: 12/02/2014, 20:20
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... values increase from G1P over PhyK to AppA by a factor of 2200 The conformational changes of AppA upon substrate binding facilitate a faster turnover of phytate and are in line with a higher specificity ... site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) Plasmid pET-1TK was used as template and Kleb(HtoA)fw (5¢-GCTTAGCCGCGCCGGCATTCG) and Kleb(HtoA)rv (5¢-CGAATGCCGGCGCGGCTAAGC) as primers ... conserved active-site motifs, RHGXRXP and HD, and hydrolyze metal-free phytate with pH optima in the acidic range They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... molecular mass calibration markers included thyroglobulin (670 kDa), apoferritin (440 kDa), catalase (230 kDa), alcohol dehydrogenase (150 kDa), conalbumin (78 kDa), albumin (66 kDa), and b-lactoglobulin ... This strain, as expected, was respiratory-deficient because of the absence of the catalytic subunit ISP (Table 1) Figure 3A shows that a band of ΔQCR9 ΔISP ΔBCS1 approximately 500 kDa was also found ... core structure V Zara et al 41 Fernandez-Vizarra E, Bugiani M, Goffrini P, Carrara F, Farina L, Procopio E, Donati A, Uziel G, Ferrero I & Zeviani M (2007) Impaired complex III assembly associated...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt
... spatial structure of a plant a- type PLD has been obtained on the basis of recombinantly produced PLDa2 from cabbage SAXS analysis (Fig 2) and analytic size exclusion chromatography indicate unequivocally ... chiral environment of the aromatic amino acid side chains, has a defined structure that presents two sharp minima at 288 and 295 nm, and two maxima at 274–283 nm (wide) and 290 nm (sharp) Storage ... PLDa2 A typical SAXS profile of PLDa2 is shown for 4.7 mgÆmL)1 in Fig 2A From scattering intensities I(0), a molecular mass of 97 kDa was calculated (using BSA as standard), which is in accordance...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx
... atoms of Asp11 and Asn23 (Fig 3) in an arrangement similar to what is observed in VPRK Both PRK and VPRK have calcium bound at Ca3 SPRK also has an aspartic acid residue at position at 200, and ... initial comparative studies showed that the catalytic turnover was at least twice that of PRK, but substrate affinity was reduced SPRK was compared with PRK and was found to be remarkable stable against ... hexa62 Table Data collection and refinement statistics for SPRK ˚ Resolution (A) Space group Cell parameters ˚ a- axis (A) ˚ b-axis (A) ˚ c-axis (A) b angle (°) Number of observations (24 – maximum...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4-amino-3-hydroxybenzoate ... 10 Takenaka, S., Asami, T., Orii, C., Murakami, S & Aoki, K (2002) A novel meta-cleavage dioxygenase that cleaves a carboxylgroup-substituted 2-aminophenol: purification and characterization of ... specificity and the cofactor References Hasegawa, Y., Muraki, T., Tokuyama, T., Iwaki, H., Tatsuno, M & Lau, P.C (2000) A novel degradative pathway of 2-nitorobenzoate via 3-hydroxyanthranilate in...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: "The Utility of a Graphical Representation of Discourse Structure in Spoken Dialogue Systems" ppt
... Discourse Structure for Spoken Dialogue Performance Analysis In Proc of EMNLP M Walker, D Litman, C Kamm and A Abella 2000 Towards Developing General Models of Usability with PARADISE Natural Language ... is not always available and users have to activate it manually Other visual improvements for dialogue-based computer tutors have been explored in the past (e.g talking heads (Graesser et al., 2003)) ... Intelligence in Education, 16 C Rich and C L Sidner 1998 COLLAGEN: A Collaboration Manager for Software Interface Agents User Modeling and User-Adapted Interaction, 8(3-4) M Rotaru and D Litman 2006 Exploiting...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx
... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... were ¨ carried out in an Aktapurifier-100 apparatus (Amersham Pharmacia Biotech UK Limited) The native PsbQ protein was first passed through a cation-exchange High-Trap SP column (1 mL) (Amersham Biosciences ... than average and their maximum values are around The values for all these parameters obtained for the PsbQ model were quite good and the programs did not mark any as poor or inappropriate Another...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
... Journal compilation ª 2007 FEBS 3135 Structure of S agalactiae STP M K Rantanen et al Table Structure refinement statistics for SaSTP against the native ˚ P21212 and SAD data SAD data collected at ... described here and is present in the S agalactiae PPase, kinase and adenylosuccinate synthase, but not in S agalactiae CovR ⁄ CsrR The motif is located at the surface of the SaPPase (Rantanen, unpublished), ... with a pKa of 7.5 [11] to achieve catalysis, a common feature in hydrolytic metalloenzymes [12] One residue that appears to take part in catalysis in HsSTP is His62, which may act as a general acid...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A ... (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...
Ngày tải lên: 07/03/2014, 12:20