... in Asia 104 p US$ 10. 00 ARROW ( 201 1) Reclaiming & Redefining Rights—Thematic Studies Series 3: Reproductive Rights and Autonomy in Asia 156p US$ 10. 00 Ravindran, T.K.S ( 201 1) Reclaiming & Redefining ... transgender couples Data was gathered in 200 0 as part of the original WHO study, but the final version was published in 200 6 Secretariat of the Pacific Community (SPC) ( 200 6) The Samoa Family Health ... Participation by Young People in International University of the Philippines Population Institute (UPPI) ( 200 2) 200 2 Young Adult Fertility and Sexuality Study 20 UNFPA and IPPF ( 200 4) Addressing the...
Ngày tải lên: 05/03/2014, 17:20
... 10. 6% 3. 3% 14 .3% Health Consciousness** 11. 200 10. 2 90 9 .38 9 Health Consciousness* 10. 939 9. 700 9.786 Repeat Visitor 70. 0% 58.1% 58 .3% Repeat Visitor 63. 6% 46.7% 69 .0% Lunch with Friends** 50. 0% ... 64 .3% 30 .6% Bachelor’s*** 47 .0% 13. 3% 28.6% 79 .0% 72.2% Age1** 60. 6% 90. 0% 69 .0% 16.1% 16.7% Age2* 22.7% 3. 3% 21.4% 25 .0% 4.8% 11.1% Age3 16.7% 6.7% 9.5% 37 .5% 51.6% 38 .9% Income1* 36 .4% 60. 0% ... of age; otherwise 12 .3% Income1 if annual household income is less than $25 ,00 0 ;0 otherwise 44.2% Income2 if annual household income is between $25 ,00 0 and$99,999; otherwise 39 .9% Income3 if annual...
Ngày tải lên: 08/04/2014, 18:33
Tài liệu Looking At the ADO Object Models ppt
... even point the object to an URL, provided the system has set it up in a consistent manner This is another way that ADO allows developers to read outside data, such as from other applications ... from other applications or over the Internet You could not this easily with DAO Figure A.1 The object model for ActiveX Data Objects 2.7 Most of the work is done in the ADODB module when you use ... Similar to the DAO Recordset object, you can open the Recordset objects as read-only or dynamic Each Recordset object also has a Fields collection Stream object This object allows you to read in special...
Ngày tải lên: 21/01/2014, 12:20
Tài liệu Looking at the SQL Server DMF APIs pdf
... the various objects within SQL Server, as well as some of the tasks that can be performed using the Enterprise Manager, so that you can perform them within your own application SQL-DTS SQL Data ... own application SQL-DTS SQL Data Transformation Services allows you to create transformation packages and tasks, much like you would by using the DTS user interface ...
Ngày tải lên: 26/01/2014, 11:20
the changes in the narratots view of sonny
... understanding of Sonny The deathof the narrator's daughter Grace was so devastating to the narrator that he said, "My trouble made hisreal"( 53) The narrator finally felt the pain and despair that had ... for whathappened to Sonny.As the story nears completion, a single event brings the narrator out of the second phase and intohis third phase It is in this final pahse that the narrator obtains a ... plagued his brother for so long It was atthat moment that the narrator found himself understanding Sonny's manhood He was on the same levelas his brother, and he was finally seeing his brother as he...
Ngày tải lên: 21/03/2014, 22:53
Finding Form: Looking at the Field of Organizational Aesthetics docx
... London: Sage Strati, A ( 200 0a) The aesthetic approach to organization studies’ In Höpfl, H (Ed.), The Aesthetics of Organization London: Sage, 13 34 Strati, A ( 200 0b) ‘Putting people in the picture: ... from the arts (Carr, 20 03 ; Watkins and King, 200 2) Many contributions draw on aesthetics to continue the critical project in management studies (Cairns, 200 2; Dale and Burrell, 200 2; Hancock, 200 2) ... often interested in the emancipatory potential of aesthetics Feldman ( 200 0) extends organizational politics to include domination through aesthetic forms Denzin ( 200 0) talks about how the aesthetics...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc
... number ARP0 X15267 Cyclin A2 NM _00 9828 Cyclin B1 NM_17 2 30 1 Cyclin C NM _01 6746 Cyclin D1 NM _00 7 631 Cyclin D2 NM _00 9829 Cyclin D3 NM _00 7 632 Cyclin E1 NM _00 7 633 Cks2 NM _02 5415 RanBP1 NM _01 1 239 RanGTPase ... CGTACATGCGCAGGATGGT AATTCATGGCCAGAGGAAAGAC TTTGTTCCTCACAGACCTCTAGCATCCAGGT 700 30 0 100 Forward Reverse Probe AAAGGAGATCAAGCCGCACAT GTTCATAGCCAGAGGGAAGACATC CTCCTCACACACCTCCAGCATCCAGTATG 30 0 500 100 ... measurements, cells were incubated with lgÆmL)1 actinomycin D (Sigma) or 20 lgÆmL)1 DRB (Sigma) for 0, 30 , 60 or 1 20 min, then stained with lgÆmL)1 Hoechst 33 342 for 30 min, and separated into G1, S and...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo hóa học: " Chemical characterization of extra layers at the interfaces in MOCVD InGaP/GaAs junctions by electron beam methods" ppt
... or In0 .02 3Ga0.977As As for sublayer of the nominal GaAs QW, it results in either In 0. 05 Ga 0. 95 As 0. 84 P 0. 16 or GaAs 0. 91 P 0. 09 by the same procedure The TEM results indicating the formation ... layer = In 0. 15 Ga 0. 85 As 0. 80 P 0. 20 and layer = In0 .05 Ga0.95As0.84P0.16 or GaAs0.91P0 .09 is congruent In fact, it matches the reasonable expectation that [In] and [P] decrease by moving away ... 0, 95 0, 05 0, 1 y 0, 15 0, 2 0, 25 0, 9 I (In 0. 15 Ga 0. 85 1-y 1,1 y 1,1 As P ) / I(GaAs) Page of 0, 8 In 0. 15 0, 7 0, 6 0, 2 Ga 0. 85 As P /GaAs 1-y y 0, 4 0, 6 y 0, 8 1,2 Figure Plot of the calculated ratio...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Research Article Exploiting Transmit Buffer Information at the Receiver in Block-Fading Channels" ppt
... in Signal Processing 10 2 100 Total packet loss rate Total packet loss rate 10 1 10 2 Nb = 10 3 Nb = 10 4 10 3 10 4 10 5 Nb = 10 5 10 6 10 12 14 16 18 20 22 Average power (dB) Figure 5: Variation ... place at the beginning of a time slot before data communication in that time slot It is also assumed that channel state information is available right at the beginning of the time slot There ... qn = 3 (2) qn = 3 (1) Y 10 = Y11 = Y12 = Y 13 = qn = Y 20 = Y21 = Y22 = Y 23 = qn = Y 30 = Y31 = Y32 = Y 33 = qn = β1 (1) β2 (1) qn = ∞ 3 (1) Y 40 = Y41 = Y42 = Y 43 = qn = Y 50 = Y51 = Y52 = Y 53 = qn...
Ngày tải lên: 21/06/2014, 22:20
Chapter 8 - Looking at International Strategies pptx
... Define international strategy and identify its implications for the strategy diamond Understand why a firm would want to expand internationally and explain the relationship between international ... strategy configurations Outline the international strategy implications of the static and dynamic perspectives DELL GOES TO CHINA Strategic decisions If we’ve not in what will soon be the second-biggest ... seeing these differences as opportunities Global perspective Global mindset Having developed skills for managing diverse teams in a worldwide work force 23 EXPATRIATES AND INPATRIATES Expatriates...
Ngày tải lên: 12/07/2014, 14:20
Báo cáo lâm nghiệp: "Human land-use, forest dynamics and tree growth at the treeline in the Western Italian Alps" ppt
... subtraction 1 709 1999 291 85 85 1 435 5 0. 14 0. 20 0 .36 Larix decidua SF FL TL 1718 1859 1881 1999 200 1 200 1 282 1 43 121 48 21 31 49 33 44 9512 22 43 25 23 0. 27 0. 24 0. 21 0 .36 0 .33 0 .33 0. 58 0. 41 0. 29 Table ... Subalpine forest (SF) 0. 60 0.54 0. 65 0. 72 0. 71 0. 75 Forest line (FL) 0. 56 0. 52 0. 48 0. 26 0 .39 0. 50 Tree-line (TL) 0. 04 0. 02 0. 01 0. 05 0. 17 0. 27 Table IV Correlation coefficients between the larch ... topography in order to reduce the microsite in uence on the tree growth [32 ] The SF plot was 10 000 m2 while the other two were 200 0 m2 ( 20 × 100 m with the long side along the contour lines) In each...
Ngày tải lên: 07/08/2014, 16:20
Báo cáo khoa học: " Is there a special mechanism behind the changes in somatic cell and polymorphonuclear leukocyte counts, and composition of milk after a single prolonged milking interval in cows" pptx
... Foods analysis regulation 200 0 .00 4, 200 001 2 10) The proportion of casein was calculated from the whey protein and total protein proportions, using a rennet casein method In short, 60 μl calcium chloride ... and 0. 05; and 0. 03 and 0. 03 , respectively Letters indicate statistically significant differences between the sampling occasion and the baseline value before the PMI a: p < 0. 001 , b: p < 0. 01, ... Dairy Sci 200 0, 83: 300 - 30 4 Blackburn PS: The variation in the cell count of cow's milk throughout lactation and from one lactation to the next Journal of Dairy Research 1966, 33 :1 93- 198 Östensson...
Ngày tải lên: 12/08/2014, 18:22
260. A Night Out at the Movies in Washington pps
... critics say the Pointer Sisters defined music of the nineteen seventies and eighties The four sisters began singing when they were children They sang with their two older brothers in their father’s ... general information about political activities America’s cable television industry created CSPAN in nineteen seventy-nine It broadcasts meetings of the United States House of Representatives In nineteen ... father’s church in Oakland, California The sisters later formed a group and became popular during the nineteen seventies Their first album, called The Pointer Sisters,” was released in nineteen seventy-three...
Ngày tải lên: 14/08/2014, 21:21
báo cáo sinh học:" Recent changes in human resources for health and health facilities at the district level in Indonesia: evidence from 3 districts in Java" doc
... sector (see Note 2) 50 55 17 4 30 37 1 657 195 32 0 119 438 93 800 498 11 50 30 5 57 35 74 20 Private practice full-time 38 35 34 25 33 39 105 99 96 107 835 877 472 5 70 14 03 1554 100 100 Ciamis District ... 672 406 506 1 200 138 2 100 100 161 205 1221 1845 8 43 1 138 2225 31 88 53 65 96 65 1 132 845 415 439 16 43 134 9 39 28 Private practice full-time 1 90 202 54 46 88 95 33 2 34 3 Total 447 472 2 407 2 736 134 6 ... Province by staff category and provider type, 200 6 and 200 8 (see Note below) Employment status General doctor Nurse Midwife All providers Percent 200 6 200 8 200 6 200 8 200 6 200 8 200 6 200 8 200 6 200 8...
Ngày tải lên: 18/06/2014, 17:20
Changes in the Economic Value of Variable Generation at High Penetration Levels: A Pilot Case Study of California pot
... 20% 30 % 40% 0. 004 % 0. 004 % 0. 004 % 0. 004 % 0. 004 % n/a n/a 0. 002 % 0. 002 % 0. 004 % 0. 004 % 0. 005 % 0. 0 03 % 0. 0 03 % 0. 0 03 % 0. 004 % 0. 004 % 0. 004 % 0. 005 % 0. 002 % 0. 004 % 0. 005 % 0. 006 % 0. 006 % 0. 001 % 0. 004 % 0. 006 % ... 18% 48% 37 % 84% 1.6 0. 7 0. 4 0. 2 2.5 1.6 4.7 5.9 7.4 4.8 100 % 15% 7% 2% 52% Wind 30 0 2 50 200 1 50 100 50 0% 5% 10% 15% 20% 30 % 40% CSP w/o TES 30 0 2 50 200 1 50 100 50 0% 2.5% 5% 10% 15% 20% 30 % Annual ... 0. 006 % 0. 007 % 0. 006 % 0. 000 % 0. 004 % 0. 008 % 0. 006 % 0. 006 % 0. 000 % 0. 002 % 0. 009 % n/a n/a n/a the CCGTs were slightly more economically attractive because the CCGTs earned greater short-run profit in non-scarcity...
Ngày tải lên: 08/03/2014, 06:20
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt
... 90 0. 069 (0. 43) 17.4 (3. 7) 100 .0 ( 100 .0) 5.4 (5 .3) 25 03 5 0. 154 0. 200 0. 0 20 1.46 0. 11 32 33 334 21 24 30 8 21 22 19.85–1. 80 (1.85–1. 80) P212121 a = 59.95 b = 65 .32 c = 96.54 a = b = c = 90 0. 03 9 ... (min)1ÆmLÆmg)1) 9 400 5 30 0 5 40 4 60 1 500 4 80 4.8 10. 6 20. 1 21.1 13. 2 8 .3 19 60 500 27 22 114 58 ± ± ± ± ± ± 4 50 35 0 30 40 100 20 ± ± ± ± ± ± 0. 5 1.2 0. 8 2 .0 1.6 0. 7 4551 Carbohydrate binding sites in Candida ... P212121 a = 60 .33 b = 65 .39 c = 96.49 a = b = c = 90 0. 052 (0. 21) 13. 8 (3. 3) 98.9 (95 .3) 3. 3 (2.6) 30 432 0. 135 0. 168 0. 014 1 .35 0. 09 32 11 38 . 23 2 .00 (2.11–2 .00 ) P212121 a = 58.57 b = 64. 63 c = 94.48...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt
... enzyme in its purified form showed a single band of 87 00 0 ^ 30 00 Da In SDS/PAGE, the same enzyme, showed two subunits of 54 00 0 ^ 200 0 Da and 33 00 0 ^ 100 0 Da [ 10] q FEBS 200 1 TNBS inactivation ... Gra3P DH of EAC cells is a heterodimer containing two subunits of Mr 54 00 0 ^ 200 0 and 33 00 0 ^ 100 0 Therefore we partially sequenced both the subunits of this enzyme The sequences for Mr 33 00 0 ... enzymes In the present work, we have partially sequenced the two subunits of the EAC enzyme: 16 amino acids for the Mr 54 00 0 ^ 200 0 subunit and 20 amino acids for the Mr 33 00 0 ^ 100 0 subunit...
Ngày tải lên: 24/03/2014, 04:21
Fate of Pharmaceuticals in the Environment and in Water Treatment Systems - Chapter 3 pdf
... Extract + 1 500 ng 7.5 8 .0 8.5 9 .0 9.5 Retention Time (min) 10. 0 10. 5 FIGURE 3. 4 Chromatogram of a standard containing 500 ng of EE2 [m/z (–) 295] is compared with samples containing the extract ... Science and Technology 35 (17): 33 97 34 06 10 Albert, A and Rees, C.W., 1956 Avidity of the tetracyclines for the cations of metals Nature (London, United Kingdom) 177: 433 – 434 © 200 8 by Taylor & Francis ... 200 8 by Taylor & Francis Group, LLC Sample Preparation and Analysis of Solid-Bound Pharmaceuticals 93 1 800 SAX-HLB (c) HLB (b) SAX-tC18 (d) tC18 (a) 1 600 Intensity (mAu) 1 400 (a) 1 200 (b) 100 0...
Ngày tải lên: 18/06/2014, 16:20
AEROSOL CHEMICAL PROCESSES IN THE ENVIRONMENT - CHAPTER 3 pot
... The Time to Start Crystallization Velocity of Blowing (cm s–1) Experimental Value (s) Calculated Value (s) 40 90 1 60 0 .39 0 0.155 0. 100 0 .35 0 0.145 0. 046 TABLE 3. 2 The Time to Form Crust Substance ... saturated vapor Radial coordinate Radius of drop Time = R02 D2–1 = R02 D1–1 Temperature of liquid inside drop © 200 0 by CRC Press LLC L829/frame/ch 03 Page 59 Monday, January 31 , 200 0 2 :06 PM The ... exists inside a drop, that © 200 0 by CRC Press LLC L829/frame/ch 03 Page 52 Monday, January 31 , 200 0 2 :06 PM 52 Aerosol Chemical Processes in the Environment d∑ x dZ ≅− dx Z ( τ) dτ (3. 33) The gradient...
Ngày tải lên: 18/06/2014, 19:20
Heavy Metals in the Environment: Using Wetlands for Their Removal - Chapter 3 docx
... from 100 to 50, 000 µg/g as a function of the concentration in water increasing from 0. 0 03 to 1 .0 µg/g Lead uptake by sea grasses was positively correlated with temperature and inversely correlated ... (1 to 36 ) ppb Lead in these sediments ranged from
Ngày tải lên: 18/06/2014, 19:20