... Installing Spark An Example Spark Applications, Jobs, Stages, and Tasks A Scala Standalone Application A Java Example A Python Example Resilient Distributed Datasets Creation Transformations and ... A Weather Dataset Data Format Analyzing the Data with Unix Tools Analyzing the Data with Hadoop Map and Reduce Java MapReduce Scaling Out Data Flow Combiner Functions Running a Distributed MapReduce ... part are about data formats Chapter 12 looks at Avro, a cross-language data serialization library for Hadoop, and Chapter 13 covers Parquet, an efficient columnar storage format for nested data...
Ngày tải lên: 13/09/2016, 11:24
... tie a bow Teach good health habits Teach and talk about washing hands n Teach and talk about brushing and flossing teeth 16 n n Eat healthy meals together and talk about what you are eating ... at each age and stage of development A free service called LOCATE: Child Care is available to help you find child care that meets your needs LOCATE can help you evaluate the quality of care and ... normally? Parents may wonder if their child is developing at a normal, healthy pace Maybe he seems late starting to talk or early starting to crawl What’s normal anyway? n “ earn the Signs Act...
Ngày tải lên: 24/02/2014, 18:20
DNA, RNA and proteins
... creating a protein chain • Just like linking letters to make words, linking amino acids makes proteins Amino Acid Amino Acid Amino Acid DNA and Mutations Mutations are any changes that take place ... chain DNA and Protein Synthesis - Summary DNA and Protein Synthesis Practice making mRNA using the DNA template DNA and Protein Synthesis • Amino acids are linked together in the same order as ... cells, can be passed on to offspring • Mutations can be neutral, beneficial, or harmful • ex: Blue eyes – a mutation that occurred 610,000 years ago, can be traced back to one ancestor • what kind...
Ngày tải lên: 13/03/2014, 16:38
Turning Many Projects into Few Priorities with TOC pot
... current task can be When faced with assessing system capacity, many handed off before moving to the queued task, organizations typically go into a major dataminimizing the set-down, set -up, and half-finished ... S Patrick Page Protects Critical Chain from Non-Critical Task Variation Protects Due Date from Critical Chain Variation projects—can still be overwhelming and distracting if resources are faced ... Summary—Many projects, a few clear priorities In PMI’s A Guide to the Project Management Body of Knowledge, a program is defined as “ a group of projects managed in a coordinated way to obtain...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Translational incorporation of L-3,4-dihydroxyphenylalanine into proteins docx
... (5¢-TATGACTAG TAGCTAGGGATCCTAAG) and 684 (5¢-AATTCTTAG GATCCCTAGCTACTAGTCA) was first inserted between the NdeI and EcoRI sites of pETMCSI to generate the new vector pETMCSIV (4670 bp) containing ... proteins associated with various disease states in humans and animals is well established, and is assumed to arise largely by postranslational oxidation of tyrosine residues by oxygen free radicals ... Patrick Schaeffer for assistance with plasmid construction This work was supported by grants from the National Health and Medical Research Council of Australia (to R.T.D., K.R.) and the Australian...
Ngày tải lên: 16/03/2014, 22:20
báo cáo khoa học: "Detection of DNA mismatch repair proteins in fresh human blood lymphocytes - towards a novel method for hereditary non-polyposis colorectal cancer (Lynch syndrome) screening" doc
... human mismatch repair proteins and dual role of PCNA in mismatch repair Nucleic Acids Research 1998, 26:1173-1178 Yamasaki Y, Matsushima M, Tanaka H, Tajiri S, Fukuda R, Ozawa H, Takagi A, Hirabayashi ... Santa Cruz, Santa Cruz, CA Santa Cruz, Santa Cruz, CA Polyclonal Antibodies Anti-MSH2 (Ab-3) Pc57 Calbiochem, San Diego, CA Anti-MLH1 (Ab-2) Pc56 Calbiochem, San Diego, CA Rabbit anti-MSH2 A3 00-02 0A ... microsatellite analysis are accurate, but are more expensive, take longer to do, and are mainly available at commercial laboratories Also, DNA sequencing and microsatellite analysis is often done on patients...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo y học: "Phylogenetic and structural analysis of centromeric DNA and kinetochore proteins" doc
... 27 TCAC TG TCAC TG A G 5? 6 bits Saccharomyces bayanus Magnaporthe grisea Neurospora crassa 3? interactions Saccharomyces mikatae 1 Saccharomyces paradoxus Saccharomycotina Candida albicans 3? ... budding yeast Candida albicans and fission yeast Schizosaccharomyces pombe, plants such as Arabidopsis thaliana, and metazoans such as Drosophila melanogaster and Homo sapiens, are longer and more ... Saccharomyces paradoxus Saccharomyces cerevisiae Candida glabrata refereed research bits A T >86% 2 Candida glabrata T 5? 83-86 bp A T A C bits G A G + + AT content TCAC TG - S paradoxus CDEIII...
Ngày tải lên: 14/08/2014, 16:21
Turning Data into Information
... string expression Add the DataColumn to the parent DataTable Generate a DataTable from a DataView Create the original DataTable Create a new DataView instance, passing the DataTable object to its ... 6 Turning Data into Information 103 Note In addition to creating custom DataView instances, each DataTable can have its own default DataView This data view, located at DataTable.DefaultView, ... the DataTable.AcceptChanges method The DataRowView.Row property returns the actual row based on other settings in the DataRowView instance Creating a DataView To create a DataView from a DataTable,...
Ngày tải lên: 03/10/2013, 00:20
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... Nakagawara A, Sakuma Y, Kimura S, Ikeda T, Satoh M, Takahashi N, Sato N & Mori M (2000) p73: structure and function Pathol Int 50, 589–593 23 Levrero M, De Laurenzi V, Costanzo A, Gong J, Wang ... [38] or anti-HA (Sigma) Gels were dried and autoradiographed using Phosphorimager Storm Band intensities on the gels were quantified with image-quant software Average values and standard errors ... AC, Frederick CA & Lippard SJ (1995) Crystal structure of double-stranded DNA containing the major adduct of the anticancer drug cisplatin Nature 377, 649–652 29 Zlatanova J, Yaneva J & Leuba...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx
... ratio obtained at h (data not shown) At 30 the basolateral ⁄ apical uptake ratio was 9.1 ± 3.7 and 5.2 ± 0.3 for 5-dayand 15-day-differentiated cells, respectively At 24 h the basolateral ⁄ apical ... between apical and basolateral glutamine uptake was smaller at the end of the differentiation period This originated from the fact that basolateral l-[3H]glutamine uptake decreased considerably ... dose and route of supplementation Data from a meta-analysis suggested that glutamine supplementation in critically ill patients may be associated with a decrease in complications and mortality rate,...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo Y học: A Raman optical activity study of rheomorphism in caseins, synucleins and tau New insight into the structure and behaviour of natively unfolded proteins pot
... measured at room temperature ROA data originating in artefacts from buer bands have been cut out in some places Fig The backscattered Raman and ROA spectra of recombinant human wild-type tau46 ... The j-casein was prepared by adaptation of two other methods, each of which employs an acid precipitation stage to isolate the whole casein, a calcium precipitation stage to partially separate the ... laser wavenumber The ROA spectra are presented as raw circular intensity differences IR ± IL and the parent Raman spectra as raw circular intensity sums IR + IL, where IR and IL are the Raman-scattered...
Ngày tải lên: 21/02/2014, 15:20
Báo cáo khoa học: Assembly of nuclear DNA-encoded subunits into mitochondrial complex IV, and their preferential integration into supercomplex forms in patient mitochondria doc
... Fellowship, and M.M by an NHMRC Career Development Award fellowship References Tsukihara T, Aoyama H, Yamashita E, Tomizaki T, Yamaguchi H, Shinzawa-Itoh K, Nakashima R, Yaono R & Yoshikawa S (1996) The ... was supported by gra from the Australian National Health and Medical Research Council (NHMRC) and the Australian Research Council D.T is supported by an NHMRC Principal Research Fellowship, and ... is that a specific accessory factor is associated with this late-stage intermediate that is displaced after integration of the subunits into the final complex Alternatively, Cox 6a and Cox 7a may integrate...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
... polyadenylation signal AAUAAA [21] Analysis of the 3¢ end polyadenylation sites of the H-strand encoded RNAs by cDNA sequencing, has revealed that the putative polyadenylation signal, AAUAAA, is conserved ... genome immediately upstream of tRNAPhe (16274-5¢-ATTACG CAATAAACATTAACAA-3¢-16295) About 1.5 mg 5¢ biotinylated synthetic double-stranded D-TERM DNA of 22 bp was bound to avidin-agarose resin ... AAUAAA [20] This canonical nuclear polyadenylation signal is believed to have a role in the 3¢ end formation of nuclear RNA polymerase II transcripts and also yeast mt mRNAs [21,22] Similar A/ T-rich...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Drosophila proteins involved in metabolism of uracil-DNA possess different types of nuclear localization signals pdf
... (5¢-CGGCATGGACGAGCTGTACAAGAAGCCCA AAAGGAAGAAGAAGAGGGAGGAGGCGGCGTGAT TCTAGACAGAGC-3¢), UDE346–349-YFP-Rev (5-CGGC ATGGACGAGCTGTACAAGGCAAAGCCCAAAAGGA AGGCGGCGTGATTCTAGACAGAGC-3¢) and yfp-For (5¢-CTAGCAAGCTTACCACCATGGTGAGCAAGGGC ... CCAAGAAGATGAAGATCGACATGGTGAGCAAGG GCGAGGAGCTG-3¢), NLSD(10)12)-For (5¢-CTAGCAAGC TTACCACCATGGCGAAGAAGATGAAGATCGACAT GGTGAGCAAGGGCGAGGAGCTG-3¢) and NLSD(10)13)For (5¢-CTAGCAAGCTTACCACCATGGCGAAGATGA ... To amplify the desired coding sequences, primers NLSwt-For* (5¢-CT AGCAAGCTTACCACCATGGCGCCAGCTGCCAAGA AGATGAAGATGGTGAGCAAGGGCGAGGAGCTG-3¢), NLSD(10)12)-For* (5¢-CTAGCAAGCTTACCACCATGGC GAAGAAGATGAAGATGGTGAGCAAGGGCGAGGA...
Ngày tải lên: 15/03/2014, 11:20
Báo cáo khoa học: 3¢- to 5¢ DNA unwinding by TIP49b proteins docx
... NaCl and mm b-mercaptoethanol After sonication and centrifugation for 30 at 25 000 g, the clarified lysate was applied to a Fast-Flow Ni-NTA agarose column (Qiagen, Valencia, CA, USA) Rvb2p was ... Kurokawa Y, Matsu-ura T, Makino Y, Masani A, Okazaki K, Morishita T & Tamura TA (1999) TIP49b, a new RuvB-like DNA helicase, is included in a complex together with another RuvB-like DNA helicase, ... LC-MS ⁄ MS for the absence of contamination by bacterial ATPases and helicases In all cases, pooled purified monomer and hexamer fractions were quantified using the Bradford assay and aliquots were...
Ngày tải lên: 15/03/2014, 11:20
The future of internal audit is now Increasing relevance by turning risk into results pot
... 2012 Evaluate • Assess KPIs against mandate value scorecard • Re-evaluate strategy and audit plan • Employ continuous improvement 1) Leverage the organizational strategy To create value and maximize ... nature and doesn’t focus on longterm strategic planning for internal audit Internal audit may have a charter and an annual plan, but many not have a higher-level, internal audit-specific strategic ... communicate Key learning: Create a strategy document that details internal audit’s strategic vision, key initiatives, relevant KPIs and an implementation plan that maps initiatives against a timeline,...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo khoa học: DNA mediated disassembly of hRad51 and hRad52 proteins and recruitment of hRad51 to ssDNA by hRad52 pot
... 5¢—TTTCCCAGTCACGA CGTTGTAAAACGACGGCCAGTGCCAAGCTTGCAT GCCTGCAGGTCGACTCTAGAGGATCCCCGGGTAC CGAGCTCGAATTCGTAATCATGGTCATAGCTGTTT CCT—3¢ DNA concentrations are expressed as total nucleotide concentrations The oligonucleotide ... mM ATP (lane 6–10) and analysed by native PAGE (6% acrylamide) followed by silver staining Lane and has hRad51 (10 lM) without DNA and lane 11 had hRad52 (10 lM) with DNA The position of asterisk ... mM ADP (lanes 5–8), mM ATP (lanes 9–12), mM ATPcS (lanes 13–16) and analysed by native PAGE ( 6% acrylamide) followed by silver staining (B) Centrifugation assay hRad51 was incubated with varying...
Ngày tải lên: 16/03/2014, 14:20
turning science into business patenting and licensing at public research ppt
Ngày tải lên: 18/03/2014, 15:22