chapter 1  robotlegs is a lightweight framework for actionscript 3

Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

... ligand for LESTR ⁄ fusin and prevents infection by T-cell-line-adapted HIV-1 Nature 38 2, 833 – 835 1950 N Charnaux et al Pablos JL, Amara A, Bouloc A, Santiago B, Caruz A, Galindo M, Delaunay T, ... Y, Kadomatsu K, Yuzawa Y, Matsuo S & Muramatsu T (2004) A small interfering RNA targeting vascular endothelial growth factor as cancer therapeutics Cancer Res 64, 33 65 33 70 Elbashir SM, Martinez ... Glycan and glycosaminoglycan binding properties of stromal cell-derived factor (SDF) -1alpha Glycobiology 10, 21– 29 34 Valenzuela-Fernandez A, Palanche T, Amara A, Magerus A, Altmeyer R, Delaunay...

Ngày tải lên: 16/03/2014, 18:20

15 423 0
Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

... replace Ser274 in ik3-1 cDNA with Thr or Ala, mutagenic primers, 50 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA -30 or 50 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA -30 (corresponding to amino-acid ... A and dn indicate cyclin E, cyclin A and a dominant-negative form of cdk anti-FLAG Ig, we obtained a larger amount of 32 P-labeled FLAG –p70ik3-1 from these cells (Fig 3A, lane of the upper panel) ... C-terminal domain of RNA polymerase II (data not shown) To examine another possibility, namely that p70ik3-1 is a substrate for cdk3, we generated GST-tagged proteins of ik3-1 in E coli, and tested...

Ngày tải lên: 24/03/2014, 04:21

7 308 0
Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx

Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx

... 5′GTCTCTCTGGTTAGACCAG -3 , Primer C 5′-CTAGTCAAAATTTTTGGCGTACTC -3 and primer A and sj4. 7A 5′- TTGGGAGGTGGGTTGCTTTGATAGAG -3 for spliced Kb transcript For GAPDH forward 5′ CTCTGCTCCTCCTGTTCGAC 3 and GAPDH ... major nuclear matrix proteins Proc Natl Acad Sci USA 1991, 88:1 031 2-1 031 6 51 Hisada-Ishii S, Ebihara M, Kobayashi N, Kitagawa Y: Bipartite nuclear localization signal of matrin is essential for ... anti-HA antibody and alexa 488 tagged secondary antibody Intracellular distribution of matrin3 was examined by confocal imaging Additional file 3: Figure S3 Matrin increased the stability and promoted...

Ngày tải lên: 13/08/2014, 01:21

10 313 0
Some studies on a probabilistic framework for finding object-oriented information in unstructured data

Some studies on a probabilistic framework for finding object-oriented information in unstructured data

... www.cs.cmu.edu/tom/newchapters.html [22] T S Jayram, Rajasekar Krishna-murthy, Sriram Raghavan, Shivakumar Vaithyanathan, and Huaiyu Zhu Avatar information extraction system IEEE Data Eng Bull [ 23] Sándor ... can have a range constraint and a text attribute can be either a term or a phrase Example 2: An object query for “an apartment in Cau Giay at least 100 m2 and at most billion VND” is defined as ... document- based We also adapt the probabilistic framework to Vietnamese Real Estate domain and have a satisfactory result 1.4 Chapter summary This chapter brought an overview of web-page problem and...

Ngày tải lên: 23/11/2012, 15:04

51 394 0
A general framework for studying class consciousness and class formation

A general framework for studying class consciousness and class formation

... micro-analysis of class locations, therefore, should not be seen as an alternative to the analysis of class relations: locations are always speci®ed within relations To be ``in'' a class location is ... overall organization of class relations in some more macro-level of analysis, typically an entire society To say that someone is ``in'' a managerial class location is to claim that they are embedded ... relevant micro-units of analysis The paradigm for this usage is biology: organisms are aggregations of interconnected organs; organs are aggregations of interconnected cells; cells are aggregations...

Ngày tải lên: 01/11/2013, 07:20

31 500 0
Tài liệu Chapter 1 - Living in a Network Centric World CCNA Exploration 4.0 pptx

Tài liệu Chapter 1 - Living in a Network Centric World CCNA Exploration 4.0 pptx

... of communication that empower individuals to create information that can be accessed by a global audience such as: – Instant Messaging – Weblogs (blogs) – Wikis – Podcasting – Collaboration Tools ... characteristics of network architectures: fault tolerance, scalability, quality of service and security Install and use IRC clients and a Wikiserver H c vi n m ng Bách khoa - Website: www.bkacad.com ... support a wide range of applications and services, as well as operate over many different types of physical infrastructures Four basic characteristics that the underlying architectures need to address...

Ngày tải lên: 12/12/2013, 14:15

41 730 0
Tài liệu The Insider’s Guide to PR: Chapter 1 WORKING IN A PR CONSULTANCY doc

Tài liệu The Insider’s Guide to PR: Chapter 1 WORKING IN A PR CONSULTANCY doc

... the larger consultancies have their own bars or break-out rooms, or at least beer fridges, and actively encourage evening socialising Jason Lees Account Executive Haslimann Taylor Law graduate ... strategy Measurement and evaluation is then carried out once the programme is completed in order to help a client and consultancy plan future activity accordingly For more details, please visit ... make clear: • Experience – A consultancy offers newcomers to the industry an excellent grounding in fundamental PR practices Graduate trainee programmes, in particular, are an excellent platform...

Ngày tải lên: 13/12/2013, 04:15

2 683 1
Tài liệu Unit 1- What is a computer? pptx

Tài liệu Unit 1- What is a computer? pptx

... as in the example below Computers accept information, perform mathematical and/or logical operations then supply new information All computers have three basic capabilities A computer is a machine ... necessary changes so that the false statement become true A computer can store or handle any data even if it hasn’t received information to so All computers accept and process information in the form ... _ and _ and can store this information an a _ Lan Anh Nguyen/ ESP/HNUE Card readers, tape drives, or disk drivers are different _ for inputting information Focus a Contextual reference...

Ngày tải lên: 21/12/2013, 20:15

4 866 3
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... GCTCAGTGGTGGA -3 and 5-CTGAGGGAAGCAAG AATGGA -3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC -3 and 5-AACTGGTGAAGCGGAAG AGAC -3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT -3 and 5-GCATCATTTCCTGGAGGAAAG -3 ... Yonezawa M, Maruyama K, Yamaguchi-Shinozaki K & Shinozaki K (2007) The mitogen-activated protein kinase cascade MKK3-MPK6 is an important part of the jasmonate signal transduction pathway in Arabidopsis ... Y, Yang KY, Han L, Mao G, Glazebrook J & Zhang S (2008) A fungal-responsive MAPK cascade regulates phytoalexin biosynthesis in Arabidopsis Proc Natl Acad Sci USA 105, 5 638 –56 43 30 Asai T, Tena...

Ngày tải lên: 14/02/2014, 19:20

11 701 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... forming a cavity  11 A in height The size of this cavity is comparable with that of adeninelacking cobalamins, and thus allows the damaged 4940 Materials Crystalline AdoCbl was a gift from Eisai ... release of adenine-lacking cobalamins, such as CN-Cbl and damaged cofactor The fact that the relative efficiencies of metal ions for the reactivation are not always correlated with the ATPase activity ... absorbance at 36 8 nm for dicyanocobalamin (eM, 36 8, 30 .4 · 1 03 m)1Æcm)1) [35 ] Analysis of the enzymeÆreactivase complex by gel filtration Complex formation between DD and the reactivase was analyzed...

Ngày tải lên: 15/02/2014, 01:20

13 621 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

... threaten to disadvantage noncompliance Law is also similar to what Wiener and Doescher (1991)'term a structural solution, that is, a political act that mandates individual behavior For Taylor and Singleton ... coercion also can be positive and of assistance The use of law can force a behavior that is desirable to the target but is not viable because of pressure to conform to a different standard In this case, ... behave law marketing, law unable to behave resistant to behave resistant to behave education, marketing education, marketing, law education, marketing, law Carrots, Sticks, and Promises / 31 ...

Ngày tải lên: 18/02/2014, 02:20

14 780 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... USA) using the primers 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC -3 and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, ... C19 9A mutations of Shh were introduced by PCR using primers 5¢-CCTGCAGCAGCGGCAGGCA AGGTTATATAG -3 and 5¢-GGGCCCAGAGGCCAGG CCGGGGCACACCAG -3 , and primers 5¢-GGCATGC TGGCTCGCCTGGCTGTGGAAGCA -3 and ... 5¢-AA GCTTCCGGAGGCTGCTAGAGAC -3 and 5¢-GGATC CAAGAACTGTGTATGTCTG -3 The 1.6-kbp fulllength Skn cDNA, whose termination codon was changed to a BamHI site, was inserted between the SalI and the BamHI...

Ngày tải lên: 18/02/2014, 16:20

14 500 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... essential for proper retinal axon guidance and topographic mapping in the mammalian visual system Neuron 20, 235 –2 43 12 Feldheim DA, Vanderhaeghen P, Hansen MJ, Frisen J, Lu Q, Barbacid M & Flanagan ... Nucleolin is a potential ligand for PTPr 33 34 35 36 37 38 39 40 41 42 43 44 45 D E Alete et al the development and maintenance of excitatory synapses Nat Neurosci 8, 458–467 Ackley BD, Harrington ... black dots, protease cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain...

Ngày tải lên: 19/02/2014, 05:20

14 670 0
Tài liệu Báo cáo khoa học: "A Pipeline Framework for Dependency Parsing" ppt

Tài liệu Báo cáo khoa học: "A Pipeline Framework for Dependency Parsing" ppt

... correct head Complete accuracy (CA) indicates the fraction of sentences that have a complete correct analysis We also measure that root accuracy (RA) and leaf accuracy (LA), as in (Yamada and Matsumoto, ... Computational Natural Language Learning (CoNLL), pages 1–8 Association for Computational Linguistics Acknowledgements We thank Ryan McDonald for providing the annotated data set and to Vasin Punyakanok ... considered again Assume that the action taken is S, and, w.l.o.g that this is the rightmost S action taken before a non-S action happens Note that it is possible that there is a relation between a and...

Ngày tải lên: 20/02/2014, 12:20

8 581 0
Tài liệu Báo cáo khoa học: "A Unified Framework for Automatic Evaluation using N-gram Co-Occurrence Statistics" pptx

Tài liệu Báo cáo khoa học: "A Unified Framework for Automatic Evaluation using N-gram Co-Occurrence Statistics" pptx

... separately evaluated Each version was evaluated by a human evaluator, with no reference answer available For this evaluation 115 test questions were used, and the human evaluator was asked to assess ... values of R2 vary between and 1, with a value of indicating that the automatic evaluation explains perfectly the human evaluation variation, and a value of indicating that the automatic evaluation ... evaluated and similar p/r ratio as the evaluation package used by the human assessors For example, an application with a high f/c ratio, evaluated using a low p/r ratio evaluation guideline package...

Ngày tải lên: 20/02/2014, 16:20

8 462 0
Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc

Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc

... reparandum information gave a false alarm, the alternative of not skipping the reparandum is still available For each utterance in the input, the parser needs to find an interpretation that starts ... new speaker may: 1) add to what the first speaker has said, 2) start a new utterance, or 3) continue an utterance that was left hanging at the last change of speaker (e.g., because of an acknowledgment) ... be analyzed An interpretation for a text would be a series of parse trees and logical forms, one for each sentence An analogous view is often taken of dialog; dialog is a series of "utterances"...

Ngày tải lên: 20/02/2014, 19:20

8 486 0
Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx

Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx

... the translations we have allocated to the lexical items in our vocabulary will be generated Tibia is true of all NL s!/stems that translate from a natural language into some formal representation ... system are acceptable as they are proposed, is more flexible than any approach which depends on getting a reaiisable expression of the representation language from the application program and systematically ... approach to generating text from a given logical form is described The algorithm described by Shieber and his colleagues takes a realisable A- calculus expression and uses their syntactic/semantic...

Ngày tải lên: 22/02/2014, 10:20

4 502 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... helix 29 30 31 32 33 34 35 36 37 38 39 40 P R Vajjhala et al identification of a conserved domain in both spartin and spastin, mutated in hereditary spastic paraplegia Genomics 81, 437 –441 Takasu H, ... CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains used in this study Strain Genotype Source EGY48 AMY245 MATa his3 trp1 ura3 LexAop(·6)-LEU2 MATa vps4-D::KanMx leu2 ura3 his4 lys2 bar1 MATa his4...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Báo cáo khoa học: "SenseRelate::TargetWord – A Generalized Framework for Word Sense Disambiguation" doc

Báo cáo khoa học: "SenseRelate::TargetWord – A Generalized Framework for Word Sense Disambiguation" doc

... disambiguated 3. 1 Command Line The command-line interface disamb.pl takes as input a S ENSEVAL -2 formatted lexical sample file The program disambiguates the marked up word in each instance and ... lexical sample format, which is an XML–based format that has been used for both the S ENSEVAL -2 and S ENSEVAL -3 exercises A file in this format includes a number of instances, each one made up of ... pages 38 –41, Boston, Massachusetts, USA, May - May Association for Computational Linguistics Y Wilks, D Fass, C Guo, J McDonald, T Plate, and B Slator 19 93 Providing machine tractable dictionary...

Ngày tải lên: 08/03/2014, 04:22

4 350 0
w