changing the primary interface of a redundant interface
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...
- 6
- 428
- 0
Changing only the aesthetic features of a product can affect its apparent usability pptx
... aesthetics and usability of each of model, then used them, then rated them again for both aesthetics and usability The order of rating (usability-aesthetics or aesthetics-usability) and the order the ... 2 Andrew Monk and Kira Lelos usability and ratings of beauty They had 156 students rate 26 layout drawings for a bank ATM Averaging over participants and correlating across layouts they obtained ... would also permit analysis of covariance to test the goodness of fit of alternative models of causation Methodological and practical implications: There are clearly some advantages in sampling...
- 13
- 347
- 0
báo cáo hóa học:" The effect of abductor muscle and anterior-posterior hip contact load simulation on the in-vitro primary stability of a cementless hip stem" ppt
... primarily along and about the implant axis Distal migration accounted for 94 to 99% of the total translational migration The average absolute rotational migration was smaller than 0.04° in the sagittal ... motion of a triangular plate that was rigidly attached to the lateral surface of the implant through a hole in the cortex The implant motion was calculated from the motion of the triangle using a ... http://www.josr-online.com/content/5/1/40 Page of 14 Fa Fa Tabd y Tb dm x Tabd doff Tcc Fabd Fcc Fa M Where: Fa Fcc Fabd force applied by the linear actuator cranial-caudal hip contact force on the femoral head, i.e resultant of the...
- 14
- 400
- 0
Báo cáo y học: " A solitary primary subcutaneous hydatid cyst in the abdominal wall of a 70-year-old woman: a case report" pptx
... article as: Ousadden et al.: A solitary primary subcutaneous hydatid cyst in the abdominal wall of a 70-year-old woman: a case report Journal of Medical Case Reports 2011 5:270 Submit your next manuscript ... publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Figure Image of the totally excised hydatid ... rendering the diagnosis, showing the size, localization, relationship to adjacent organs, and type of the cyst It can also be used to search for another hydatid location [1,4] The radiological findings...
- 3
- 303
- 0
báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot
... facilitate the implementation of the intervention this was not possible Once the therapy allocation was made, the Research Team had to locate a suitable therapist to conduct the intervention and ... is not open to bias, and in addition majority of the interview measures were direct and quantitative rather than subjective and qualitative Statistical Analyses Data analysis was conducted on ... that only half of the initial sample had injected in the last month at baseline, would suggest a broad treatment effect i.e injecting behaviour had already stopped in half of the participants at...
- 12
- 454
- 0
The Marketing Strategy of a multinational join stock company.doc
... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...
- 25
- 623
- 8
Báo cáo y học: "The primary prevention of birth defects: Multivitamins or folic acid"
... and other candidate CAs [14] On the other hand the large population-based dataset of the Hungarian Case-Control Surveillance of Congenital Abnormalities (HCCSCA) [17] can provide a chance for the ... important than the dose of folic acid Among candidate CAs, a reduction was found in the prevalence at birth of cardiovascular CAs both after the use of the multivitamin and the high dose of folic acid ... 0.4-0.8 mg of folic acid As far as I know the Hungarian data sets are unique to answer these questions On the one hand now the results of the two Hungarian intervention trials are available and their...
- 12
- 487
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...
- 12
- 740
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...
- 6
- 387
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a...
- 9
- 533
- 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...
- 8
- 551
- 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
... studying the influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are ... Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation of laser parameters influences clearly on the transformation ... reveals that the increase of one mode photon density caused in the decrease of the other one Fig 1a Gain coefficient α1 varies Fig 1b Gain coefficient α2 varies D.V Hoang, M.H Hanh / VNU Journal...
- 4
- 343
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... neighborhood of U {x(U )}, where x(U ) is the root of U The boundary of each puzzle piece P consists of a rectifiable arc in A( ∞) and a rectifiable arc in J(F ) The latter arc starts at an iterated preimage ... Annals of Mathematics, 159 (2004), 1–52 On the Julia set of a typical quadratic polynomial with a Siegel disk By C L Petersen and S Zakeri To the memory of Michael R Herman (1942–2000) Abstract...
- 53
- 383
- 0
Đề tài " The diameter of the isomorphism class of a Banach space " pdf
... Tzafriri, Classical Banach Spaces I Sequence Spaces, -index of a Banach space, Israel J Springer-Verlag New York (1977) [Mc] R A McGuigan, Jr., Near isometry of Banach spaces and the Banach-Mazur ... lemma follows from Lemma and the the classical fact that every separable Banach space 1-embeds into C[0, 1] Lemma is false for some nonseparable spaces Partington [P] and Talagrand [T] proved that ... Annals of Mathematics, 162 (2005), 423–437 The diameter of the isomorphism class of a Banach space By W B Johnson and E Odell* Dedicated to the memory of V I Gurarii Abstract We prove that...
- 16
- 376
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of ... represents the first example of the effects of an antimicrobial peptide from frog skin on the proteome of bacteria, and demonstrates that the bacterial membranes are the major targets of its mechanism of...
- 18
- 494
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008