changing a table s background color
Praise for The iPhone Developer’s Cookbook 2nd phần 6 pptx
Ngày tải lên :
13/08/2014, 18:20
... Implementing a Very Basic Table Populating a Table Pretty much any array of strings can be used to set up and populate a table Recipe 11-1 leverages the UIFont class s capability to list available system ... Touch handles all those details for you Font Table Sample Recipe 11-1 demonstrates how to build a simple list-based table It creates a table and fills that table with all available font families.When ... fonts, that is, a handy list of strings .A call to [UIFont familyNames] returns an array populated with those font names.This recipe creates a basic table based on those font names Figure 11-1 shows...
- 88
- 357
- 0
Tài liệu Adding, Modifying, and Removing DataRowView Objects from a DataView docx
Ngày tải lên :
24/12/2013, 01:17
... SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; DataSet myDataSet = new DataSet(); mySqlConnection.Open(); mySqlDataAdapter.Fill(myDataSet, "Customers"); mySqlConnection.Close(); ... AddModifyAndRemoveDataRowViews { public static void DisplayDataRow( DataRow myDataRow, DataTable myDataTable ) { Console.WriteLine("\nIn DisplayDataRow()"); foreach (DataColumn myDataColumn in myDataTable.Columns) ... /* AddModifyAndRemoveDataRowViews.cs illustrates how to add, modify, and remove DataRowView objects from a DataView */ using System; using System.Data; using System.Data.SqlClient; class AddModifyAndRemoveDataRowViews...
- 7
- 368
- 0
Báo cáo Y học: The mechanism of nitrogen monoxide (NO)-mediated iron mobilization from cells NO intercepts iron before incorporation into ferritin and indirectly mobilizes iron from ferritin in a glutathione-dependent manner pot
Ngày tải lên :
08/03/2014, 22:20
... used as a relative measure of NO production [25,29,35] Nitrite was assayed using the Griess reagent that gives a characteristic spectral peak at 550 nm [37] Protein preparation and labelling Apotransferrin ... PAGE-59Feautoradiography (see Materials and methods) (B) Native PAGE-59Fe-autoradiographs of cellular cytosols treated as described above and densitometric results of the autoradiograph The results in (A) ... (see Materials and methods) (B) Native PAGE-59Fe-autoradiographs of cellular cytosols treated as described above and densitometric results of the autoradiograph The results in (A) are the mean...
- 10
- 503
- 0
báo cáo hóa học:" On the path to translation: Highlights from the 2010 Canadian Conference on Ovarian Cancer Research" pot
Ngày tải lên :
20/06/2014, 07:20
... classification system of tissues, and to assemble a pan-Canadian team of researchers to collaboratively advance the discovery and validation of novel biomarkers for ovarian cancer Phase I has ... screening and imaging modalities A major challenge, however, is the availability of assays that are analytically and clinically valid and useful Other considerations include the availability of reliable ... that CICs may be heterogeneous among patients or with disease progression These data are consistent with a hierarchical model of serous ovarian cancer, and implicate CD133 as a potential, but...
- 6
- 359
- 0
New trends in removing heavy metals from industrial wastewater
Ngày tải lên :
20/07/2014, 12:48
... which a person s immune system attacks its own cells This can lead to joint diseases such as rheumatoid arthritis, and diseases of the kidneys, circulatory system, nervous system, and damaging ... one-pot systems, operable at traces of the target compounds (less than ppm) Table summarizes the main advantages and disadvantages of the various physico-chemical treatments presented in this study ... wastewater laden with heavy metals Basically, adsorption is a mass transfer process by which a substance is transferred from the liquid phase to the surface of a solid, and becomes bound by physical...
- 17
- 530
- 0
Báo cáo y học: "Highlights from the Critical Care Canada Forum 2009 – 25 to 28 October 2009, Toronto, Ontario, Canada" pot
Ngày tải lên :
13/08/2014, 20:21
... respiratory distress syndrome JAMA 2009, 302:1888-1895 Kumar A, Zarychanski R, Pinto R, Cook DJ, Marshall J, Lacroix J, Stelfox T, Bagshaw S, Choong K, Lamontagne F, Turgeon AF, Lapinsky S, Ahern ... 361:1925-1934 Australia and New Zealand Extracorporeal Membrane Oxygenation Influenza Investigators, Davies A, Jones D, Bailey M, Beca J, Bellomo R, Blackwell N, Forrest P, Gattas D, Granger E, Herkes R, ... also discussed the extent to which US government legislation now restricts the activities of industry in that country In his response, Dr Detsky reasoned that there should always be a clear separation...
- 2
- 231
- 0
Báo cáo y học: " Preferences for the selection of unique tRNA primers revealed from analysis of HIV-1 replication in peripheral blood mononuclear cells" pdf
Ngày tải lên :
13/08/2014, 09:21
... 5’ TTTTAGTCAGTGTGG AAAA TCTCTAGCAG TGGTGGCCCGTACGGGGA TTGAAAGCG… 3’ NL4-3-Met 5’ TTTTAGTCAGTGTGG AAAA TCTCTAGCAG TGGTGCCCCGTGTGAGGA TTGAAAGCG… 3’ NL4-3-Pro 5’ TTTTAGTCAGTGTGG AAAA TCTCTAGCAG TGGGGGCTCGTCCGGGAT ... stimulated PBMC were added to each culture Supernatants were assayed for p24 viral antigen using an ELISA Two additional separate infections produced similar replication patterns for each virus Squares ... as the primer activation site (PAS) [23] Interestingly, a virus with similar mutations to facilitate the use of tRNAPro was not stable, consistent with the results presented in our study We suspect...
- 10
- 395
- 0
Tài liệu Process Selection From Design to Manufacture P2 pdf
Ngày tải lên :
20/01/2014, 00:20
... early stages of design appraisal, the chosen parameters must apply to all joining processes Also, it is essential that the parameters relate to knowledge that is readily available and appropriate ... much less controllable and less tangible issues than manufacturing, such as assembly actions and fixture design (2.6) In practice, assembly selection is a very difficult task It does not mean, however, ... functionality In many cases, incorrect joining processes are used due to a lack of knowledge of such factors as availability, cost and functional performance of alternatives As with primary and secondary...
- 10
- 383
- 0
Tài liệu Process Selection From Design to Manufacture P1 ppt
Ngày tải lên :
20/01/2014, 00:20
... explore candidate materials, geometries and tolerances, etc., against possible manufacturing routes This requires some means of selecting appropriate processes and estimating the costs of manufacture ... quality cost in a business As touched on earlier, such losses result from rework, order exchange, warranty claims, legal actions and recall In many businesses, these losses account for more than ... terms of means and standard deviations, across the aerospace/defence, automotive and industrial equipment business sectors This indicates that the applicability of the methods is not particularly...
- 40
- 353
- 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc
Ngày tải lên :
18/02/2014, 12:20
... Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer with NcoI site Sense ARS with PstI and SalI Antisense ARS with PstI and SalI TOP ARS Acknowledgements This work was supported ... CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa ... AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV Transcription start site β-gal Relative abundace of β-gal A PABP expression during heat shock recovery...
- 19
- 596
- 0
Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc
Ngày tải lên :
18/02/2014, 13:20
... intervals examined On the other hand, statistical signicance for HeLa samples was observed at days and after irradiation Figure 5C shows these differences for samples examined days after irradiation ... but the shape of the curves did not change It is worth noting that m1 was always positive (i.e c2 was always greater than p2), whereas m2 was always negative (i.e c1 was always greater than p1) ... origin software (OriginLab Corp., Northampton, MA, USA) Statistical analysis Students t-test was applied to the two-sample groups to compare variations in intensity of the control and irradiated samples...
- 14
- 765
- 0
Tài liệu THOUGHTS FROM THE BOARDROOM PWC MUTUAL FUND DIRECTORS ROUNDTABLE 2012 HIGHLIGHTS ppt
Ngày tải lên :
19/02/2014, 15:20
... fund) and the steps being taken to manage those risks Directors should understand the current risk management processes, ask questions where appropriate and obtain assurances that the processes are ... other asset managers Some advisers are already recording conversations with expert firms and having counsel present during calls Despite the added scrutiny, advisers see these interactions as useful ... governance as well as what questions the board should be asking the adviser about the valuation process The SEC s interest in how fund advisers are handling these risks has affected auditors expectations...
- 22
- 453
- 0
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf
Ngày tải lên :
20/02/2014, 23:20
... is a malignant neoplasm that represents the early trophoblast of the attachment phase or as later invasive stage [46–48] Thus, in most cases, choriocarcinoma has the appearance of trophoblast, ... excess (nonspecific association) of unlabeled HDL3 Subsequently, the cells were washed and lysed in 0.3 M NaOH to measure associated radioactivity The selective CE-uptake (closed triangles) was calculated ... JAr and Jeg3 cells (Fig 2B,C) for selective uptake of HDL3-associated CEs it was reasonable to assume that this pathway is caused by high expression levels of SR-BI Using specific primers for SR-BI...
- 12
- 470
- 0
Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx
Ngày tải lên :
20/02/2014, 23:20
... expression of Mcm proteins plays a role in the malignant transformation of cells Materials and methods Antibodies Rabbit anti-Mcm2 serum was prepared using mouse Mcm2 protein as an antigen, and ... Immunoprecipitation with anti-Mcm4 Ig was performed as described above (C) The radioactivity in Mcm4 in (B) was quantitated and displayed as a course of chase periods WI-38 (squares, solid line), HeLa (diamonds, ... of CIS (CIN3 of FIGO classification) and dysplasia (CIN1) was immunostained (Fig 6B) Mcm4- and PCNA-immunoreactivity showed a more diffuse distribution in dysplasia than in the normal squamous cell...
- 13
- 486
- 0
Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx
Ngày tải lên :
21/02/2014, 00:20
... reoxygenation, transcriptional or translational processes can be excluded as cause of the hypoxic arrest It was already shown for Ehrlich ascites cells that the expression of growth related mRNA is ... preinitiation state’ is similar to the known ‘classical’ prereplication complex, and that hypoxia directly influences mechanisms activating this complex Materials and methods most cells became arrested ... Cdk2 bands differ under hypoxia and normoxia Possibly, this represents a modification of the kinase influencing its activity/inactivity Post-translational processes such as modifications (e.g phosphorylations...
- 11
- 610
- 0
Báo cáo khoa học: Identification of yeast aspartyl aminopeptidase gene by purifying and characterizing its product from yeast cells potx
Ngày tải lên :
07/03/2014, 12:20
... exhibit aspartyl aminopeptidase activity These results suggest that aspartyl aminopeptidases are present in several eukaryotes Basic amino acids were conserved at several sites of the aspartyl aminopeptidases ... activity (s) was measured using a fluorogenic substrate Aspartyl aminopeptidase activity (d) was measured using MALDI-TOF MS B Results Purification of yeast aspartyl aminopeptidase A novel aspartyl aminopeptidase ... sequences are shaded, and histidines, glutamates, and aspartates conserved among all sequences are indicated with * The sites of basic amino acids conserved among all of the aspartyl aminopeptidases...
- 7
- 368
- 0
Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt
Ngày tải lên :
07/03/2014, 21:20
... product as a class IIIc AC which has a glutamineasparagine pair at the positions defining ATP as a substrate instead of the lysine-aspartate consensus We show that the purified catalytic domain of ... stabilizing asparagine does not contact the substrate and mutagenesis shows that it appears not to be involved in catalysis Furthermore the asparagine-aspartate couple which replaces the usual substrate-specifying ... glutamine-asparagine instead of lysine-aspartate All mammalian membrane-bound ACs possess a strictly conserved and spaced hexad of catalytic residues Emerging from mostly bacterial genome sequencing...
- 8
- 401
- 0
Báo cáo Y học: Tyrosine sulfation and N-glycosylation of human heparin cofactor II from plasma and recombinant Chinese hamster ovary cells and their effects on heparin binding pot
Ngày tải lên :
08/03/2014, 22:20
... demonstrated again the very similar sialylation degree of both proteins Table summarizes the glycosylation characteristics of recombinant and serum HCII based on mass spectrometry results and HPAEC-PAD ... conotoxins alpha-PnIA and alpha-PnIB: further investigation of labile sulfo- and phosphopeptides by electrospray, matrix-assisted laser desorption/ionization (MALDI) and atmospheric pressure MALDI mass ... Conradt, H .S. , Sanz, L & Calvete, J.J (1999) Structural characterization of the oligosaccharide chains of native and crystallized boar seminal plasma spermadhesin PSP-I and PSP-II glycoforms Eur J...
- 12
- 489
- 0
Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx
Ngày tải lên :
16/03/2014, 12:20
... binding and catalysis In the sequence, it was easy to recognize the signal peptide, several potential glycosylation sites, as well as a GPI anchor at its C-terminus This anchor is possibly an adaptation ... resulting apterous insects were used as 9-day-old adults Chemicals Buffer salts, detergents, molecular-mass markers, protein inhibitors, and most substrates were purchased from Sigma-Aldrich (St Louis, ... the synthesis of several peptides used as substrates, to Dr C Ferreira Aphid midgut aminopeptidase for helpful discussion, and to Mrs L.Y Nakabayashi for technical assistance We thank Mrs L Duportest...
- 15
- 391
- 0
Báo cáo khoa học: Protection of chylomicron remnants from oxidation by incorporation of probucol into the particles enhances their uptake by human macrophages and increases lipid accumulation in the cells ppt
Ngày tải lên :
16/03/2014, 16:20
... using a kit from Promega UK, and first-strand synthesis was carried out using Avian myeloblastosis virus reverse transcriptase The primers used and the product sizes for the genes tested are shown ... TTCCTCACACTGGCACTTGTA GGGGTTGTAGAGTTCCAGGTC ATTGCCCTTTACCTCCTCGT AGATGCAGCCTCATTTCCAC ATGAGGTTGGCTTCCATGTC TGGGTTTTCAACTGGAGAGG GAAACTGCAGCTGAGCCTCT ACCTACTTGGCTCCGGATTT CTACAAGGCAGGCAGTATTGG CCTGTGTTGAGGGAGTACCTG ... was measured Fluorescence per cell in macrophages treated with DiIlabelled CRLPs or pCRLPs was quantified by absorbance volume analysis The fluorescence for the entire field was assessed, the background...
- 11
- 291
- 0