cd4 t cell counts
Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx
Ngày tải lên :
13/08/2014, 01:21
... 5′-CTAGTCAAAATTTTTGGCGTACTC-3′ and primer A and sj4.7A 5′- TTGGGAGGTGGGTTGCTTTGATAGAG-3 for spliced Kb transcript For GAPDH forward 5′ CTCTGCTCCTCCTGTTCGAC 3′ and GAPDH reverse 5′ TTAAAAGCAGCCCTGGTGAC 3′ primers ... Identification of novel import and export signals of human TAP, the protein that binds to the constitutive transport element of the type D retrovirus mRNAs Mol Cell Biol 1999, 19:6306-6317 40 Strasser ... indicated) Cell lysates were subjected to immunoprecipitation with anti-HA antibody Western blot analysis of co-immunoprecipitations shows that interaction occurs between Rev and Matrin in the...
- 10
- 313
- 0
Báo cáo khoa học: Isolation, characterization, sequencing and crystal structure of charybdin, a type 1 ribosome-inactivating protein from Charybdis maritima agg. potx
Ngày tải lên :
16/03/2014, 14:20
... model The rotation function with the correlation coefficient based on intensities and with the highest Patterson correlation coefficient was chosen to be the correct solution, in spite of the fact that ... rabbit reticulocyte translation system, the estimated IC50 of 27 nm indicates that it is not such a strong inhibitor of protein synthesis as other RIPs The active site of RIPs, which contains ... content The asymmetric unit of the crystals contains one protein molecule The crystals diffract ˚ synchrotron X-rays to 1.37 A resolution Data collection, structure solution and refinement The final...
- 9
- 424
- 0
SUCCESS FACTORS OF PLACE MARKETING: A STUDY OF PLACE MARKETING PRACTICES IN NORTHERN EUROPE AND THE UNITED STATES doc
Ngày tải lên :
23/03/2014, 04:21
... is often the most competitive part of the process In the fifth step, the choice basket of attractions includes the potential of the 100,000 communities In the last sixth step, the buyer must choose ... distant competitors cannot match Porter (2001) suggests that the same thinking about competitiveness should be applied to regional economies as to the rest of the economy, and that the traditional ... multiple goals, such as to build a positive image for the place and attract enterprises, tourists, institutions, events etc Today, places need to attract tourists, factories, companies and talented...
- 274
- 1.8K
- 0
Báo cáo Y học: Isolation, enzymatic properties, and mode of action of an exo-1,3-b-glucanase from Trichoderma viride doc
Ngày tải lên :
24/03/2014, 04:21
... similar structure of subsites at its active center where A21 has a negative value for affinity energy in contrast to values for all other sites that are positive mutarotation had occured to a significant ... of the oligoglucoside substrate and there is no interaction between subsites; secondly, the subsite affinities are additive The important thing is regularity of a value for the intrinsic rate ... germinated barley has been reported to have negative affinity at site 12 and positive at the rest [53] This is in contrast to the results obtained for the exo-1,3-b-glucanase described here where the...
- 9
- 554
- 0
Population structure attributable to reproductive time: isolation by time and adaptation by time docx
Ngày tải lên :
28/03/2014, 16:20
... joint evolution of ‘habitat preference’ (here, heritability of reproductive date) and a trait determining adaptation to habitat type (here habitat type is the selective environment on a given date) ... comparison with spatial theory The model, detailed in the online supplementary materials, tracks the evolution of the joint breeding value distribution for two quantitative traits: the date when an ... constraints, direct environmental influences, adaptive tactics, and adaptation to particular times Disentangling this complexity, must await the demonstration that each mechanism can work on its...
- 16
- 443
- 0
Báo cáo lâm nghiệp:"Aboveground biomass relationships for beech (Fagus moesiaca Cz.) trees in Vermio Mountain, Northern Greece, and generalised equations for Fagus sp." ppt
Ngày tải lên :
08/08/2014, 01:21
... reported that, for very old dicot trees, H µ D0.474 implying that mature trees taper so as to maintain a constant elasticity throughout the tree In this study, the 95% confidence intervals for the ... studied the scaling of tree height with respect to stem diameter using the stress and the elastic similarity models Assuming a constant stem density, predictions about the relation between trunk ... predicting the biomass of other tree compartments did not substantially contribute to the Allometric equations for Fagus trees 443 Figure Stump biomass MSP in relation to DB The slope is statistically...
- 10
- 287
- 0
Báo cáo y học: "Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries" pps
Ngày tải lên :
09/08/2014, 22:23
... therefore optimized the reaction conditions on the PCR machine with the fastest heating and cooling rate - the machine that performed most poorly with the standard protocol We extended the denaturation ... of biotin-adapter-ligated DNA fragments by streptavidin capture Non-phosporylated biotinylated Illumina adapters were prepared by annealing 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCxT and 5’-GATCGGAAGAGC ... up to this point no explicit DNA-fractionation step had taken place other than the clean-up steps Analyzing the ligation mixture of adapter-ligated fragments by qPCR would not reveal potential...
- 14
- 346
- 0
Báo cáo y học: "Genetic analysis of HIV-1 Circulating Recombinant Form 02_AG, B and C subtype-specific envelope sequences from Northern India and their predicted co-receptor usage" pot
Ngày tải lên :
10/08/2014, 05:21
... using two internal sets of primers with following sequences: It is fairly well established that HIV-1 that uses CCR5 chemokine receptor (R5-tropic) is transmitted preferentially than the ones that ... Forward primer: CTGTTAAATGGCAGTCTAGC Reverse primer: CACTTCTCCAATTGTCCCTCA Patient population and genetic analysis We carried out genetic analysis of 13 HIV-1 envelope sequences from Northern India ... genotyping tools located at NCBI http://www.ncbi.nlm.nih.gov/ projects/genotyping/formpage.cgi, REGA subtyping tool ver 2.0 http://www.bioafrica.net/subtypetool/html and Recombination Identification...
- 6
- 417
- 0
báo cáo khoa học: "Isolation of specific and biologically active peptides that bind cells from patients with acute myeloid leukemia (AML)" doc
Ngày tải lên :
10/08/2014, 22:20
... differentiating cells even after days of culture Thus the mechanism of differentiation by the peptides appears to be novel and different than that of the known conventional differentiating agents It ... with an imaging reagent, the peptides could be used to locate sites of tumor sanctuary The peptides could also be combined with peptides that selectively target the tumor vasculature [15] The ... multiple variables The maturation state at which the AML clone is arrested is defined by the FAB subtype and this may be a factor that determines the specific response to the peptide We have not...
- 9
- 226
- 0
báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf
Ngày tải lên :
12/08/2014, 03:21
... (TGATATTTGGTCTGCCATGGGCG, CATTTCCCTGCATGTATTCAATGCC, CCACCACATAGTTAGACCGTGATGC) Authors' contributions BjH, DH, MY, CIK and JB designed experiments, conducted the data analysis and interpretation ... oligonucleotide primers (shown in 5'-3' orientation) were designed based on the sequence scaffolds of PGB02 (AATTGGTCAATTCCTAAAACACCATG, AAATTATGGGTTTTAAGGGCTAGAGTTC) and PGB04 (AACAAATTTACTCATTTA CCCGTGA, ... PGB02 contains a unique and conserved repeated sequence of 44 bp (TCAGGTTCTGCCATTGCCTTTTTAGTTCATTATCTTGAGCTGCC) which is located four times (with no more than two nucleotide changes) between -21...
- 13
- 329
- 0
Báo cáo y học: " Comparative evaluation of INNO-LiPA HBV assay, direct DNA sequencing and subtractive PCR-RFLP for genotyping of clinical HBV isolates" pot
Ngày tải lên :
12/08/2014, 04:20
... CTTGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAACT 360 C T- KWT-43 X65259 X75669 TGTCCTGGTTATCGCTGGACGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTG ... CAAGGAACCTCTATGTATCCCTCCTGTTGCTGTACCAAACCTTCGGACGGAAATTGCACC 600 C-A T A -A A - KWT-43 X65259 X75669 TGTATTCCCATCCCATCATCTTGGGCTTTCGGAAAATTCCTATGGGAGTGGGCCTCAGCC ... TGTCCTGGTTATCGCTGGACGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTG 420 -T T -A KWT-43 X65259 X75669 CTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGCTTGTCCT 480 T ...
- 5
- 370
- 0
Báo cáo khoa học: " Evaluation of rapid screening and pre-emptive contact isolation for detecting and controlling methicillin-resistant Staphylococcus aureus in critical care: an interventional cohort study" doc
Ngày tải lên :
12/08/2014, 23:21
... MRSA-positive patients acquired a MRSA infection in one of the ICUs This study is the first to report detailed time intervals from patient admission to notification of MRSA test results in critically ... findings show that factors other than laboratory analysis may have an effect on total time from admission to notification of test results, and that efforts are warranted to reduce these delays The added ... limitations First, we used a rapid MRSA test that lacks perfect specificity and sensitivity Therefore, we cannot exclude the possibility that the test artificially increased the number of isolation...
- 8
- 320
- 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 1 4
Ngày tải lên :
10/09/2015, 15:48
... Experimental Section 217 reducing the concentration window to span single digit concentrations within the identified range Cell uptake studies Uptake studies were conducted by treating cells at a ... endpoint for the cytotoxicity assays Mitotic arrest was identified by staining of the microtubules with BODIPY-FL pacitaxel and actin with FITC-phalloidin, and counting the cells on a fluorescent ... hours The reaction mixture was cooled, filtered through Celite, washed with acetone and the filtrate was concentrated by rotary evaporation The residue was dissolved in water and extracted three times...
- 142
- 421
- 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 5
Ngày tải lên :
10/09/2015, 15:49
... 278.0 HO O I 316 Appendix OTs 3-2 C22H19IO7S2 586.4 TsO O I FT-IR Data 317 OBn 3-3 C13H12O 184.2 318 Appendix TsO O OTs 3-24 C57H48O15S4 1101.2 OBn OTs O OTs FT-IR Data 319 3-5 C29H24O7 484.5 ... 544.4 TsO I FT-IR Data 329 TsO OTs OBn 5-19 C53H44O13S4 1017.2 OTs OTs 330 Appendix MeO O O 3-40 C19H14O5 322.3 O OMe FT-IR Data 331 HO O O 5-23 C17H10O5 294.3 O OH 332 Appendix TsO OTs 3-56 C30H34O7S2Si ... C30H34O7S2Si 598.8 O TES FT-IR Data 333 HO OH 3-57 C16H22O3Si 290.4 O TES 334 Appendix HO O 3-35 C16H22O3Si 290.4 O TES FT-IR Data 335 HO O 3-34 C10H7IO3 302.1 O I 336 Appendix FT-IR Data 337 HO O 5-28...
- 30
- 265
- 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 6
Ngày tải lên :
10/09/2015, 15:50
... Appendix Low-Resolution-Mass Data 3-2 C22H19IO7S2 586.4 TsO O OTs I 347 OBn 3-3 C13H12O 184.2 348 Appendix TsO O OTs 3-24 C57H48O15S4 1101.2 OBn OTs O OTs Low-Resolution-Mass Data 349 HO O OH 3-4 ... O O O O 362 Appendix Low-Resolution-Mass Data OTs 5-18 C20H17IO6S2 544.4 TsO I 363 TsO OTs OBn 5-19 C53H44O13S4 1017.2 OTs OTs 364 Appendix Low-Resolution-Mass Data MeO O 3-40 C19H14O5 322.3 O ... 366 Appendix TsO OTs 3-56 C30H34O7S2Si 598.8 O TES Low-Resolution-Mass Data 367 HO OH 3-57 C16H22O3Si 290.4 O TES 368 Appendix Low-Resolution-Mass Data HO O 3-35 C16H22O3Si 290.4 O TES 369 HO O...
- 34
- 228
- 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 7
Ngày tải lên :
10/09/2015, 15:50
... High-Resolution-Mass Data 381 O TsO I OTs 3-2 C22H19IO7S2 585.9617 382 Appendix OBn 3-3 C13H12O 184.0888 TsO O OTs 3-24 C57H48O15S4 1100.1876 OBn OTs O OTs High-Resolution-Mass Data 383 HO O ... C44H32O8 688.2097 O O High-Resolution-Mass Data 399 TsO I OTs 5-18 C20H17IO6S2 543.9511 400 Appendix TsO OTs OTs OTs OBn 5-19 C53H44O13S4 1016.1665 High-Resolution-Mass Data 401 MeO OMe O O O 3-40 C19H14O5 ... C16H22O3Si 290.1338 TES High-Resolution-Mass Data 407 O HO TES O 3-35 C16H22O3Si 290.1338 408 Appendix O HO I O 3-34 C10H7IO3 301.9440 High-Resolution-Mass Data 409 H O O O TsO OTs H 3-61 C36H28O10S2...
- 38
- 257
- 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 8
Ngày tải lên :
10/09/2015, 15:50
... M J Discovery of Laetirobin as a Late-Stage Mitotic Blocker that Induces Programmed Cell Death (poster presentation) th 57 Natural Products Gordon Research Conference, Tilton, NH, USA, 2008 Lear ... 2009 Reux B., Simon O., La Clair J J., Lear M J Total Synthesis of Laetirobin: a Late-Stage Mitotic Blocker that Induces Cell Death (poster presentation) rd Mechanobiology Workshop, NUS, Singapore, ... Novartis Institute for Tropical Diseases, Singapore 2011 - present Research Investigator – Chemistry Development of anti-malaria therapeutics Boehringer Ingelheim, Vienna, Austria Research Scientist...
- 12
- 185
- 0
Báo cáo khoa học: "Isolation and identification of Escherichia coli O157:H7 using different detection methods and molecular determination by multiplex PCR and RAPD" docx
Ngày tải lên :
07/08/2014, 18:21
... GTGGCGAATACTGGCGAGACT CCCCATTCTTTTTCACCGTCG ACGATGTGGTTTATTCTGGA CTTCACGTGACCATACATAT GCGCTGTCGAGTTCTATCGAGC CAACGGTGACTTTATCGCCATTCC CCGCAGCCAA GCGATCCCCA Expected size Reference 614 bp Fagan et al ... shed STEC more frequently than adults In this study, most fecal samples were obtained from healthy adult cattle Putting these studies together, age difference might be attributable to low detection ... stx2-F stx2-R eaeA-F eaeA-R hlyA-F hlyA-R H7-F H7-R CRA22 CRA23 11 Oligonucleotide sequences (5'-3') ACACTGGATGATCTCAGTGG CTGAATCCCCCTCCATTATG CCATGACAACGGACAGCAGTT CCTGTCAACTGAGCAGCACTTTG GTGGCGAATACTGGCGAGACT...
- 13
- 456
- 0
Báo cáo khoa hoc:" Development and assignment of bovine-specific PCR systems for the Texas nomenclature marker genes and isolation of homologous BAC probes" ppt
Ngày tải lên :
09/08/2014, 18:21
... containing the bovine gene [12] and which serves as a reference for the establishment of the Texas nomenclature [14] For RB1, heterologous primers: RB1F: CTTGTGTGATTAACTTATTTAGAG and RB1R: AATGTGAACTTAGTAGCAAAAGAC ... proposed together with their diagrammatic representations In the following years, some confusion in the bovine nomenclature led Popescu et al [14] to dene the Texas standard nomenclature during the third ... international meeting for the standardisation of cattle karyotype held in College Station (Texas) It resulted in the choice of 31 marker genes already mapped in man to permit unambiguous identication...
- 10
- 278
- 0
báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc
Ngày tải lên :
12/08/2014, 03:20
... CGTTCTATT, Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, ... USA) The primer sequences for the various genes were: JAIP-For5'CAATCAAAGCTCCCTTTTCG, Rev5'AAGCCCGAAAACTCCAC TCT; Cat-For5'GAGTGGTTGATGCCCTGTCT, Rev5' TCTCATCTCGATCCCCAAAG; PEAMT-For5'TTGCCCTTGAG ... Rev5'CTGGACCTAATCCC GTCAAA; Actin-For5'AAACCACAAGCCCCTAAACC, Rev5 'TTGCATCACTCAGCACCTTC The PCR reaction conditions were also set as per the instruction manual in the kit After the completion of the...
- 25
- 292
- 0