cataract surgery in people with a severe learning disorder

báo cáo hóa học: " Improvement of quality of life, anxiety and depression after surgery in patients with stress urinary incontinence: Results of a longitudinal short-term follow-up" docx

báo cáo hóa học: " Improvement of quality of life, anxiety and depression after surgery in patients with stress urinary incontinence: Results of a longitudinal short-term follow-up" docx

... The FACT-G Social Well-being scale comprises mainly items regarding social support rather than participation in social acitivities The finding that at baseline patients in the surgical treatment ... scales are concordant since decreased social withdrawal and avoidance, reduced psychosocial impact and less embarrassment are accompanied by better emotional and functional well-being Not assessed ... Giannantoni A, Di Stasi S, Cucchi A, Mearini E, Bini V, Porena M: Pelvic Floor Muscle Behaviour During Valsalva Leak Point Pressure Measurement in Males and Females Affected by Stress Urinary Incontinence...

Ngày tải lên: 18/06/2014, 19:20

11 456 0
Báo cáo hóa học: " Applying a brain-computer interface to support motor imagery practice in people with stroke for upper limb recovery: a feasibility study" docx

Báo cáo hóa học: " Applying a brain-computer interface to support motor imagery practice in people with stroke for upper limb recovery: a feasibility study" docx

... The feature separability was quantified off-line using the cross-validation estimate of the CA obtained with a linear discriminant analysis approach amplitude was proportional to the classifier’s ... from a BCI with moderate CA A moderate accuracy feedback may frustrate the subject and thus cause more of a distraction rather than assistance in performing MI of rehabilitative tasks There is also ... Visual Analogue Scale (VAS) [29,32] The scale was marked as “No fatigue” at one end and ‘Worst fatigue imaginable’ at the other As fatigue and mood are often correlated it was decided to asses each...

Ngày tải lên: 19/06/2014, 08:20

17 530 0
Báo cáo hóa học: " The happiness of people with a mental disorder in modern society" pdf

Báo cáo hóa học: " The happiness of people with a mental disorder in modern society" pdf

... De Giralamo, G, Gluzman, S, Gureje, O, Haro, JM, Kawakami, N, Karam, A, Levinson, D, Medina Mora, ME, Oakley Brown, MA, Posada-Villa, J, Stein, DJ, Adley Tsang, CH, Aguilar-Gaxiola, S, Alonso, ... Veenhoven et al 2011) This leads to a somewhat paradoxical conclusion that people with mental disorders are happy if they have the characteristics that are usually associated with good mental health ... psychopathology Figure provides more detail about the various mental disorders involved A first point is that people diagnosed as abusing alcohol are as happy as people without any mental disorder...

Ngày tải lên: 21/06/2014, 06:20

6 340 0
Báo cáo y học: " Abnormal macrophage response to microbial stimulus in a 43-year-old man with a severe form of atherosclerosis: a case report" pptx

Báo cáo y học: " Abnormal macrophage response to microbial stimulus in a 43-year-old man with a severe form of atherosclerosis: a case report" pptx

... Department of Internal Medicine at the University Teaching Hospital in Cagliari His clinical manifestations started in 2002 with a sudden onset of neurological symptoms Magnetic resonance imaging ... dissuaded us from performing a coronary angiograph His family history for cardiovascular events was negative A brain MRI revealed mild cortical atrophy with bilateral lacunar ischemic lesions and ... with bilateral lacunar ischemic lesions and gliosis in the cerebral white matter, mainly in the semi-oval center and the corona radiata Page of of systemic hypertension, polycythemia, brain injury...

Ngày tải lên: 11/08/2014, 12:20

5 409 0
Báo cáo y học: " Physical health behaviours and health locus of control in people with schizophrenia-spectrum disorder and bipolar disorder: a cross-sectional comparative study with people with nonpsychotic mental illness" ppt

Báo cáo y học: " Physical health behaviours and health locus of control in people with schizophrenia-spectrum disorder and bipolar disorder: a cross-sectional comparative study with people with nonpsychotic mental illness" ppt

... data KB conducted the data analysis and interpretation and produced the initial manuscript draft All authors read and approved the final manuscript Competing interests The authors declare that ... reported eating at least one fruit a day [39] Physical Page of 10 inactivity and poor diet in the form of low fibre and high saturated fat intake have already been postulated to partly explain the increased ... affecting physical health it appears that lack of awareness and a lack of prioritisation are the main obstacles to improving physical health in this population group Furthermore, people with SMI are...

Ngày tải lên: 11/08/2014, 15:22

10 388 0
Báo cáo y học: " Adenovirus serotype 7 associated with a severe lower respiratory tract disease outbreak in infants in Shaanxi Province, China" pps

Báo cáo y học: " Adenovirus serotype 7 associated with a severe lower respiratory tract disease outbreak in infants in Shaanxi Province, China" pps

... 7U GAACCAGGAACCAGTCTT GTGGATGGGGAAGGATAC 20586-20603 20543-20560 506 7L TAAAGCAGGGTGGGCTCA 21031-21048 8U CATACCGTTCTCCAGCAACT 20914-20933 8L ATCAAAAAGGTAGCAGGT 21405-21422 9U CGCCATAGTCAACACTGC ... GCAAAAGCTGATATGACAG 19412-19430 4U CATTGGCTTCAGGGATAAC 19288-19306 4L TGGCGTGTACTTGTAAAC 19748-19765 5U GGCAACAATCTGGCTATG 19661-19678 5L GAGGTTGATGCTGGTGAA 20136-20153 6U TGGAAATGACCTCAGAAC ... infection has not been established; and adenovirus vaccines are presently unavailable in China Most of the adenovirus infections especially severe pneumonia in infants was diagnosed clinically without...

Ngày tải lên: 11/08/2014, 21:21

7 271 0
Báo cáo y học: "The association between subchondral bone cysts and tibial cartilage volume and risk of joint replacement in people with knee osteoarthritis: a longitudinal study" pptx

Báo cáo y học: "The association between subchondral bone cysts and tibial cartilage volume and risk of joint replacement in people with knee osteoarthritis: a longitudinal study" pptx

... were tabulated Annual percentage change in cartilage volume was calculated by cartilage change (follow-up cartilage volume subtracted from initial cartilage volume) divided by initial cartilage ... Osteoarthritis Index Competing interests The authors declare that they have no competing interests Authors' contributions SKT was involved in data analyses and manuscript preparation AEW was involved in manuscript ... greater loss of medial tibial cartilage volume over a 2-year period in longitudinal analyses, as well as an increased risk of knee-joint replacement over a 4-year period Our findings suggest that...

Ngày tải lên: 12/08/2014, 12:20

7 425 0
Báo cáo y học: " Withdrawal of inhaled corticosteroids in people with COPD in primary care: a randomised controlled trial" potx

Báo cáo y học: " Withdrawal of inhaled corticosteroids in people with COPD in primary care: a randomised controlled trial" potx

... criteria on diary cards for a COPD exacerbation but was not managed with antibiotics or oral steroids b) A moderate exacerbation was defined as a COPD exacerbation treated with a course of antibiotics ... of patients with COPD in the UK and the Netherlands are managed exclusively in primary care, a figure increasing with the rising awareness and identification particularly of mild COPD in primary ... primary care [3] and hospital admission [4] Patients who have repeated exacerbations have an increased rate of decline in lung function [5,6] and have a greater deterioration in health status...

Ngày tải lên: 12/08/2014, 15:21

12 382 0
Báo cáo y học: "Effects of rehabilitative interventions on pain, function and physical impairments in people with hand osteoarthritis: a systematic review" docx

Báo cáo y học: "Effects of rehabilitative interventions on pain, function and physical impairments in people with hand osteoarthritis: a systematic review" docx

... intensity of training Additional material Additional file 1: Appendix 1: Detailed search strategy is attached as an appendix Abbreviations AUSCAN: Australian/Canadian osteoarthritis hand index; CI: ... distal interphalangeal (DIP), and proximal interphalangeal (PIP) joint movements of the 2nd-5th fingers AUSCAN, Australian/Canadian osteoarthritis hand index; CHFS, Cochin hand functional scale; ... SMD were based on the following hierarchy: (a) for pain, measures of global hand pain took precedence over pain on motion and the Australian/Canadian OA hand index (AUSCAN) pain subscale [18];...

Ngày tải lên: 12/08/2014, 15:22

13 320 0
The use of a frailty index to predict adverse health outcomes (falls, fractures, hospitalization, medication use, comorbid conditions) in people with intellectual disabilities

The use of a frailty index to predict adverse health outcomes (falls, fractures, hospitalization, medication use, comorbid conditions) in people with intellectual disabilities

... related to an age-related decline in health Since falls, in the general population, increase with age, this contributes to the explanation that age-related frailty is associated to increased fall ... risk In this study we did not observe an increase in falls with age Also, the explained variance of the model was low (explained variance = 13%) and mainly related to previous falls, indicating ... Both diagnosis and ATC-code were used to classify participants as having a problem, disease or condition regarding that organ systems (Table 1) Although originally included in the ATC classification,...

Ngày tải lên: 25/08/2016, 23:25

9 332 0
Tài liệu Diagnosis of smear-negative pulmonary tuberculosis in people with HIV infection or AIDS in resource-constrained settings: informing urgent policy changes docx

Tài liệu Diagnosis of smear-negative pulmonary tuberculosis in people with HIV infection or AIDS in resource-constrained settings: informing urgent policy changes docx

... 97–107 Harries AD, Maher D, Nunn P An approach to the problems of diagnosing and treating adult smear-negative pulmonary tuberculosis in high-HIV-prevalence settings in sub-Saharan Africa Bull ... AL, Fitzgerald DW, Severe P, et al Integration of tuberculosis screening at an HIV voluntary counselling and testing centre in Haiti Aids 2001; 15: 1875–79 16 Ramachandran R, Datta M, Subramani ... et al Clinical indicators of mycobacteraemia in adults admitted to hospital in Blantyre, Malawi Int J Tuberc Lung Dis 2002; 6: 1067–74 David ST, Mukundan U, Brahmadathan KN, John TJ Detecting...

Ngày tải lên: 15/02/2014, 12:20

8 567 0
Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx

Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx

... Glutamine incorporation in Caco-2 proteins determining the relative uptake of glutamine; (b) by searching for changes in the intestinal proteome; and (c) by examining glutamine incorporation into ... basolaterally administered glutamine led to a time-dependent increase of label in the cells with a maximum at 24 h, after which a steady state level was reached Remarkably, an increase of radioactivity ... cytoplasmic proteins that can bind to the membrane surface in response to elevations in intracellular calcium [45] Annexin A2 is an F-actin binding protein and participates in the formation of...

Ngày tải lên: 20/02/2014, 01:20

15 506 0
Reproductive System Structure, Development and Function in Cephalopods with a New General Scale for Maturity Stages pot

Reproductive System Structure, Development and Function in Cephalopods with a New General Scale for Maturity Stages pot

... and appear granular Oocytes are at intercalary and protoplasmic growth phase AG are completely formed and usually white Gonad is large, usually dullwhite Spermatozoa accumulate in testis ampullae ... spermatophoric gland Stage VI Mature sexual cells pass through the accessory glands In all cephalopod females this stage occurs at spawning In males, spermatophores accumulate in the distal part ... sicula and Sepiel /a ornata (our data) Stage III The gonad is maturing and accessory glands become fully formed The gonad is large In the ovary granular structures are clearly visible Three substages...

Ngày tải lên: 14/03/2014, 16:20

12 624 0
Behavioral Treatment for Substance Abuse in People with Serious and Persistent Mental Illness pptx

Behavioral Treatment for Substance Abuse in People with Serious and Persistent Mental Illness pptx

... trademarks, and are used only for identification and explanation without intent to infringe Library of Congress Cataloging -in- Publication Data Bellack, Alan S Behavioral treatment for substance ... in central Philadelphia and, during the late 1980s and early 1990s, drug abuse, especially abuse of crack cocaine, was an epidemic in the area This tragic circumstance increasingly affected people ... usage As long as they actively participate in the education and training, they can acquire skills and information that may be of use at some time in the future In addition, we also assume that...

Ngày tải lên: 29/03/2014, 00:20

283 878 0
Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

... protein interaction domains in PSD-95: an intramolecular interaction between a ‘hook’ domain and guanylate kinase domain keeps the molecule in a closed state [28,29] In conclusion, our crystallographic ... (C-terminus) and P)2, but not at P)1 and P)3 other than through main chain hydrogen bonds with bB In most class I PDZ domain-ligand pairs, additional interactions engaging the amino acid residues at ... plasticity and basal GluR -A localization [10], suggesting developmental plasticity and ⁄ or existence of multiple parallel pathways in GluR -A transport To date, four PDZ domain-containing proteins have...

Ngày tải lên: 30/03/2014, 10:20

11 458 0
Báo cáo hóa học: " Gait kinematic analysis in patients with a mild form of central cord syndrome" pdf

Báo cáo hóa học: " Gait kinematic analysis in patients with a mild form of central cord syndrome" pdf

... was calculated as the average of the values obtained in the five trials considered A descriptive analysis was made of the clinical and functional variables by calculating the mean and standard ... kinematic parameters, possibly acting as a confounding factor, a comparison was made with the kinematic data obtained when the control subjects walked at a speed similar to that of the CCS patients ... certain bias in the data from the control group since walking slowly may modify their normal gait Since there are many parameters that can be obtained from gait analysis, it is necessary to take...

Ngày tải lên: 19/06/2014, 08:20

10 440 0
báo cáo hóa học:" Factors associated with psychological and behavioral functioning in people with type 2 diabetes living in France" pptx

báo cáo hóa học:" Factors associated with psychological and behavioral functioning in people with type 2 diabetes living in France" pptx

... mean that factors were not included in the final multivariable model Underlining indicates the most important association with the DHP scores a Presence of myocardial infarction, angina or heart ... myocardial infarction and angina Moreover, no information about the time of occurrence was available The presence of both complications was associated with a more important decrease than a single ... Detournay B, Fagot-Campagna A: Prevalence of macrovascular complications and cardiovascular risk factors in people treated for diabetes and living in France: the ENTRED study 2001 Diabetes Metab...

Ngày tải lên: 20/06/2014, 15:20

8 470 0
Báo cáo hóa học: " Albuterol enantiomer levels, lung function and QTc interval in patients with acute severe asthma and COPD in the emergency department" pptx

Báo cáo hóa học: " Albuterol enantiomer levels, lung function and QTc interval in patients with acute severe asthma and COPD in the emergency department" pptx

... Moderate to severe asthma exacerbation was diagnosed by independent emergency physicians, in accordance with the National Asthma Council Australia (NAC) guidelines [31] Acute asthma sample and data ... details School of Pharmacy, University of Tasmania, Hobart, Tasmania, Australia Menzies Research Institute, University of Tasmania and Department of Respiratory Medicine, Royal Hobart Hospital, ... collection and undertook the laboratory analysis KYC and GAJ performed the statistical analysis All authors helped draft the manuscript All authors read and approved the final manuscript Competing interests...

Ngày tải lên: 21/06/2014, 03:20

8 412 0
Endarterectomy versus Stenting in Patients with Symptomatic Severe Carotid Stenosis pptx

Endarterectomy versus Stenting in Patients with Symptomatic Severe Carotid Stenosis pptx

... cerebral infarction in six patients (including one who had a disabling nonfatal stroke and none who had a fatal stroke) and cerebral hemorrhage in three (including two who had a fatal stroke) All but ... monitoring Systemic complications in the endarterectomy group were infection (mainly pulmonary) in five patients, unstable angina in one, gastrointestinal bleeding in one, and subdural hematoma in ... the primary outcome Had a nondisabling stroke Had a TIA and had a myocardial infarction between randomization and stenting Underwent endarterectomy Endarterectomy attempted in 257 Stenting attempted...

Ngày tải lên: 27/06/2014, 00:20

13 263 0
Báo cáo toán học: "The maximum number of perfect matchings in graphs with a given degree sequence" docx

Báo cáo toán học: "The maximum number of perfect matchings in graphs with a given degree sequence" docx

... (2.1), and no ri is zero Therefore, after permuting the rows and columns of the adjacency matrix of G it is a block diagonal matrix in which every block is an all-1 square matrix, and as our graph ... matchings M1 , M2 is a 2-regular spanning subgraph H as above, and for every cycle of length exceeding in H there are two ways to decide which edges came from M1 and which from M2 The permanent ... states n perm A ≤ (ri !) ri , (2.1) i=1 where equality holds (if no ri is zero) iff up to permutation of rows and columns A is a block diagonal matrix in which each block is a square all-1 matrix...

Ngày tải lên: 07/08/2014, 15:22

2 367 0
w